Description :
From Genome Similarity Track
Location :
Scaffold_224:360301- 362296
Transcript NameFunction/comments
Aphin_H310_09434PPAT5

Sequence
1995 bases(100 bases per row)
GGCCAATGGCTTACAATTCGTCATGATCTTCATCGTCATCGTCGTCGCCGCCCGCGGCGCCGGCACCGCCGGTGGATTGGTACACCTTGGCCATGATGGG
GTTTGCGATCTTTTCAATGGCCTTTTGCTGAGCGTCAAAGTCTTCCTTGTCAGCTTCTTGGTTTTCGTCCAACCAGTCCATGGCTTCTTGGACCGCCTTC
AACAACGTGTCCTTGTCGGCTTCTTCAATCTTGTCGGCCAACTTGTCTTCGACATTGTTCTTCAAGTTGTAGAGGTAGCCTTCCAACGAGTTGCGACCGT
CAATGCGGTCCTTGATCTTCTTGTCTTCTTCCGCGTTTTCTTCCGCTTCTTGCACCATGCGGTCAATTTCTTCTTGCGACAAGCGACCCTTTTCGGCCGT
GATCGTAATCTTCTCGGCCTTGCCCGTGCCCTTGTCTTCTGCAGACACTTGCAAGATACCGTTGGCGTCGACTTCAAACGTGACTTCGATTTGGGGCACA
CCACGAGGAGCAGGGGGAATGCCGGTCAATTCAAACTTGCCGAGAATGTGGTTGTCTTTGGTCATGGCACGTTCACCTTCAAACACTTGGATCGACACAG
CGGGTTGGTTGTCCTGGTAGGTCGAGAAGGTTTGCGACTTCTTGGTGGGGACGACCGTGTTGCGGTTGATAATCTTGGTCATGACACCACCGACAGTTTC
AATGCCCAACGACAAGGGCGCCACATCCAACAACAAGATTTCGTTCAGGTTGGAGTCGTTTTCGCCACCCAAGATACCGCCTTGCACGGCGGCACCGTAC
GCGACAGCTTCATCAGGGTTGATGCCGCGCGAAGGTTCCTTGCCGTTAAAGAAGTCCTTGATCAGTTGTTGGATCTTTGGGATACGAGTCGAACCACCCA
CAAGCACAATTTCGTCGACTTCGCTCTTCTTCAACCCAGCATCCTTCATTACCTTTTCCACGGGGGTCAACGTCTTTTTGAACAAGTCATTGTTCAGTTC
TTCAAAACGAGCTCGGGTCAGCGTTTCGTCGAAATCTTCGCCGTCCAAGAGAGATTCAATTTCGAGACGGGCTTGGGGCTGGGTCGACAAAGCGCGCTTG
ACACGTTCGGCTTCACGGCGGAGCTTTTGCAACGCGCGCTTGTCGCTGGAAATGTCGATCTTCTTTTGCTTTTGCCACTTCTTGATGAAAAATTGCATAA
TGCGCTGATCGAAGTCTTCACCGCCCAAGTGCGTGTCACCGTTGGTCGACAACACCTCAAACACACCACCATCGATGGTCAACAAGGTGACATCGAAGGT
ACCGCCACCCAAATCGAACACCAACACGTTCTTTTCACCCTTGGCCTTCTTGTCAATACCGTACGCAATCGCGGCAGCCGTCGGTTCGTTGATAATACGT
TGCACGGTCAAACCAGCAATGGTACCAGCATCCTTGGTAGCTTGACGCTGAGCATCGTTGAAGTACGCAGGCACAGTCACAACAGCGTCGTGCACTTCCT
TGCCGAGGTAGTTTTCGGCAATAGTCTTCATCTTGGTCAAGATCATGGCGGACACTTCTTCAGGAGAGAATTGCTTGGCCTCGCCCTTGATCTTGACTTC
AATAAAAGGACGTCCGTCCTTGTTGACGATGTGGAAAGGCAGCAACTTCTTGTCGGCTTGAACCGACTTGTCGTTGTAGCTGCGGCCGATCAAACGCTTC
ACGTCGAACAATGTGTTTTCGGGGTTGATCGTGGCCTGGTTCTTGGCACCGTCCCCAATCAAACGTTCGTCGTTCGAGTCCCACGCGACATACGACGGCG
TGATACGGTTACCCTGGTCGTTCGCAATGATTTCCACCTTGCCGTTGGCGTAGTGCCCGACGCACGAGTACGTCGTGCCGAGATCGATACCGATCACAGG
CCCCTTCGGTTCTTGAGCCATCGCAGAGCTCATGAGGCACGCCGCCGCGAGTCCCGCAGCGTACGCGAACGTCTTGATCAAGTTCATCTTTCCTT