Description :
From Genome Similarity Track
Location :
Scaffold_666:3603- 5256
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_666-fgenesh-gene-0.1Endo-1,3(4)-beta-glucanase

Sequence
1653 bases(100 bases per row)
CGTCCTGCGCCGCGCCACCTTCCGACGCGTTCCGCCGCAGCGACGAGCTCCGCTCGCTCATCACACCACGCTTCCTGCACCCGAATGTTCCTCATGACCG
CCCCGTACCGACCAACGCCTGGTGGGGCAACCTACTCGCATGGGACGGCCAGAAGGAGAGCGACGCGGTCTTCAGCTCGCCATACACGCACAAGGTGGTG
CAGGGCCAGCCCGGCGCGATCGGCTGTGGCTTCTCCGTGAGCTACCTCGCGCAGTACCGCGTGGACGGACCGATGAACGACAACGGCGCGATCCGCTACT
ACTACTACCCACCGACGATCAAGAACCTGCTCTTTTCGGCGCTTGAGCTGAGCGTCGCAAACGGCGCGACGGCTCCACCGTTTACTATCGATGCGTGGGA
TGATTTGGGCGTTGTGTTGACACTTGCGCTAGGGCTGACGAGCTTCATGCGCACGTACTTGGCCGTGGGCAACGCGTTCACGACGGTCCAATACGAGGAC
CTACACGTGCAGCTCTGCTCGGACCACGGGTGGCTGACGATCAACGGCCAGCCACTGCGCGATGGACAGGAGTACTCGGGCCAGTCGTTCGTGATAACGT
TCAACAATGGACAGAAGTGGAACCTGTTCTTCTTTCCGAATAACGCGTCGGCATCGACAGTCATCCGCTTCCAGAACAACAAGCTCACGACGAGAGACAA
GTTTGACGGGTTTGTACAGGCTGCGTACGTCTCGAACAAGCCAGACGGCGACGCTACGGATACAAGCATCTTGCAGCTCTACCAGCGGTCGGCCGGTGTG
TTTGCGAAAGGCGCGCGTGTGGTGCACGAGGATGGCAACGCCGAGTCGTTCAGCTTTGACTGGAAGCTCGTGACTGTCCCTTCCAAGGAGCATGACAAGC
CGCTCTTTTTGCACTTCGCGCTCGACCATCTGCGCCAGATGTTTGTCAGCTCGTCTTACACCTCATCAGTGGCGCCCAAGCCAGAGCTGACGCTTCACGC
GCACACGCGCGGCCCCATGCAGGCGTACACCACGGAAACGTCGTCGCCCAAGTGGGAGTTCCGCGTGCCGTTGACCATCAGCGCGGATGTGGAGAAGTAC
ACTGCATTCTACCCACCGCAGGCGAGCCTGTCGCCGGACAGAGTGGCGGCGCTCAACCTTTGCCAAGTGCTCAAGGACGAGATTTATGGGGATTGGGACC
AAGCTTTGCCGCACGAAGGCAGCTACTACTTCAAGGGCAAGGCGCTACAGAAGTTCGGCACGATGTGTCTGTTGGCAAAGAAGCTCGCGGAGACCACGAA
CCCGGAGATGCACGACGTCGCACAGCACGGCATTGGGCATCTGCAGACGATCTTCAAGGCTTTTGTAGAGAACAAGTCGGCGTACCCGCTGGTCTACGAC
ACGGTCTATAAGGGCATCATCACCAGCGAGGCGTTCGTGAAGCGCGACATCAACGTGGACTTCGGCAACGCGGTCTACAACGACCACCACTACCACTACG
GGTACGTGATCACGGCCGCGGCGATGATGCTGCACTTGGGAGGTGACGCATGGAAACACTCTGAGGACGCCGTGAAGCTGCGCATGTTCATCGACACTTT
GGTGCGCGACGTGATCAACCCTTCAGACGGAAACGAGTTCTTCCCTCGCTTTC