Description :
From Genome Similarity Track
Location :
Scaffold_27:36028- 37950
Transcript NameFunction/comments
Phyra_94956PREDICTED: similar to WD repeat domain 19 putative

Sequence
1922 bases(100 bases per row)
TGCTAGCTCTATGATGAACGAGCATATCCGAATAATATTCGACATGTCAAAGCCAGTAATGGAGGTGGAGTCGGGGCTCTCGCTGTCTTTGCAATTGTGT
TCACGTTGCGGAGTCAGCACCGGATGCAATTGCGGCTGGCGGCAAGACCATGCTATCTGGCCGCAATTGGAACATCTTAGCATTTTGGAATTCGTCGCCT
CCAGTTTGGTAAGGATCTAATACTTAGGATACCATACCATACCATACCTTCATAAACCTGACGAATTTGGGGCTACATGCACAGCCTTTTACCGCTACTG
CAAAAACGGCATCATGCTTCAACCTGCACCTTCGCGAACGTCGAAAAGAGAACATTTCAAACTTCAGTATCCAAAACTTCGGGCATAAAGTCCAGCGACC
GATGGTTGAATGTCCCTACACGGTACGTGTTATCATACAATGCTCAGCCATTCAGCAGTTCTTACTTTCTCATGCCAATACTGCCTAGGTATTCAAGATA
GAGTTACATCTCGGCAATTTAACGTGGCGAATATCTCGGCGATATCGTGAGTTTGTTAAGTTGCACAGCCGCTTAAAAGTGACAATTCGACACGACAAAC
TTCCTCAGCTTCCATCTTCAAAATGGTGCGTGCCGATAGCTCTTCGCTGCTATCCGCGAACTCACACCAGTTTGTCTGAATTTACAGGTTTGCGGTAACA
GAGCATAGTTTTCTTCTTCGCCGGCAACGTCTACTTGAGAACTACCTCAAGGGAATATTTATGATCGAGGAGATCCAAGATACAGTTCCTTTGCTTGCAT
TTCTTGGAGGTCAGTTACGGGATGGATCTCTCTGCTCATTTGCATTATCCGCTTTTTACTCAGCCAATGATTTGCTTGACTGGGTCAAATGTCGTGCACA
GTACTCTCAACATCTTACTTTGATCACGTGGCATTGCGAAACTACCGCCGGCAAATACTTCACCTCCAGGTGCTAGAATTCTACACTCGGCCAGGGGATT
TAATTCTCTTCAATAGCCGAGCCAAAGTCAGCGGAATTCAACGATCGGTGAGTCTTAAAAAACTGGTCTTGCCCTCTTTTCAACGCACTGACGAACCACA
TCACCCTACCTTGCTGCTCCAGATGACAAGATCGGAATGGGATCACGTTGCTATTGTCGTTCCATCTCGCGACAATAGTAACCTTCAGCTCCTGGAGGCA
ACAGGTGACGGCGTCACGTTAACTCCTCTGGTGCGTATGCTATCGCCGAGCTGAAGAGCACAATACTAACCTGGCTGCTCTTGCTGCTTCACAGACCGCA
CGGCTTCTAGCATATTCAACTTTCCATGTGCGGTATTTCGTGCTGAGGAAACTCCACACTCCGTTGCTTTCTCGAGCTGTTGTGAACGACTTGCTCGAGC
GCTTCGCTTCTGAGGTTCGTGGCAACTCGTTGACAAGAAACAACATCGTGCTGAACGGTGGCTGGTGAATTCCAGGTTGAGGGCCTTCCCTACGGTTTGA
GCATCCGGAGGATTCTTCACGCAAAACAAGCAGAGCAATCTCGATCACGTGGCAGTACATTCTTCTGCTCTGAATTGGTTCGTTCAGCCAGGAAACCCAG
CTCTACCAGTTCGTTCGCCCAGTATTGATATTTCACCTCATACGCAGGTGGCAGAAGCTTATCAAGGGCTCGGAATCATCTCAAGCTCCAGCGAGGCAAA
CGATTTCTGGCCTGGTACGCAATTCCACAGAGCAGATGACTCGTACAGGTCAACTAAAACTAACCTCTCTCCAGGATCATTTTCACCCGGAGACTTTGCC
GATGCTGAACTTGCTCGCCACGGTGCCTCACTGAGCCCCGAGATCATCATCGATTGTAAGCTGCTAGAAGTCGCCACCGCCACACAGCGATCTCAAAACC
CAGCTTTACACTAAAACTAATA