Description :
From Genome Similarity Track
Location :
contig_61:36025- 37540
Transcript NameFunction/comments
g10842.t1hypothetical protein

Sequence
1515 bases(100 bases per row)
ACTGTCGCAGGGGTTGCATACTTCAGATCCCGGATTTCAAATAAGAGTCGCATGTTCGGCTTCAGCGGGATGCGCTCATTCGAAGCAAGCGTGAGCATTT
TATTGTCATCCATGACAGAGTTCATCGACTCAATCCAGTTAGCGTCCAGGTCTCCATCCAGTACAATCCATTTCGGGCGAGGGTCTGCGACCGAACTACT
AGCCACGTCGCGCATGATCTTAGACAATAGACCATCTTTCCATTCTCGTGTACCAAGCACCATATATCCATAAAGATCTTCAGTAGAAACTGACTTGGGG
TTGAGGTCAATGACTTTCGTCGTGTACTGCTCGCCTTTCTTCTTCCGAGCAGCAATAAGCGTCTCACAGCACTCCGTTTTACCACTTCCCGGTGGCCCCA
TCACAAAGACACAGTGACGAATTGCTAGCAGCTCTTCCAGCTGAATAACTTTCAGCCGGAACTGTTCATGCGGCCAAAGCCCGCGATCCTCGCACGCAAC
GTGAACGTACTTCTCCATCACCTCGTCGATCTTCCGCGGTAGGTTCAGGTTGGGGAAGAGATCACCAAGTAGCCCCGTGAATATAAGTAGGTCCTGTTTC
ACGATTTTGGGCAAGTTAAAATCTCGAAGGGAGCGCATCAGAATTTCTTGCTCGGAAAATTTCGGCTCAGCACGCTTAAAGGTACCAGCAACGACGAGTA
CACTTTTGACAGCTCGAAGGCCCCAGTCATAGTGGTCTTGTTTAGAGAGAAGCTCTCGAAGCAAGGAATATAGACTAAAGAATTTCGTAGCAAGAAGCTT
CGCCTCTCGGAATCCTTCTGCCATTAGCATGTTCTCGCAGATCAACACGAGATCGGGCGCCATCACTGTAATGGGTCGGAATAATGCTTTCAAGCCTTCA
GGCAGTTCAGAACGACCGAGATAGCCAGGATTCATGGTAATGAATGTCCCGCATGTGGGATCAAGCGTGACCGAGTCTCCTTCAACCACAACATGACTGC
TTTCGCCTCTAATTCCATCGCAGACAGCTTTGAATTGGACCGAGCACACAGATAACACTTCAGGAGCGAGACGGTTGAATTCATCAAAGCACCCCCACGC
GCCTGCACTCGCTAAGCCTTTGAAAATGTTCCCCAGATTTTTGTAGTCCATTTCAGGGGAGCAGTTAAACACATAACATACTTTGCCTACCATATTTGCA
AGATCTTTCGTGGTTTCTGTTTTTCCTGTTCCGGCAGGCCCTGCTGGAGCACAACCCATTTGAATGTGAAGAGCCTGGGTGGCAGTAACATAAATTCTGT
CAGTCAAGGGCGTGATCACGAGCCTCGGGCCATTGCCCAAATACTCGAATCCGTAGTCGAATGTTGCGTCACAGATTTCCAGATATGTGTGATTCTGATG
ATCTGACCGTCGTGGCTTTAACTGCGACTGCCAAAGGAACGAGCTAGGTATCGTGATCTCTTCATACAACAGCTTCTGCACAATATCTCGTGAATGCGCA
TCCATAGTGATCATG