Description :
From Genome Similarity Track
Location :
Scaffold_59:36022- 47031
Transcript NameFunction/comments
Phyag_g1375hypothetical protein PHYSODRAFT_511517
Phyag_g1376hypothetical protein PHYSODRAFT_354949
Phyag_g1377hypothetical protein PHYSODRAFT_259266
Phyag_g1378hypothetical protein PITG_14592
Phyag_g1379choline-phosphate cytidylyltransferase B
Phyag_g1380hypothetical protein PHYSODRAFT_286562
Phyag_g1381sporangia induced hypothetical protein
Phyag_g1382hypothetical protein PHYSODRAFT_361180

Sequence
11009 bases(100 bases per row)
TTGCTGTTGGCGCGCGAATGTGTCACTCGTAAACAAGTTGAGCGATTTCTATCCAGGATGTGTGAGTGCGTTGGCACCGTTTGAGACTCCAGATGACTCC
TCGGTACAGCAGCTCCTCTCGGTTGTTCagtcgacgcagcaccagctccatgtTGCTCGATAGCTGCGTTATCACACAAAGATCCCAGCTAGGTCAAATG
AAAGTATCAACAGGAGATCATGCGACCGTCCTACCTGTTTGGTGCATGGCTCCGAGAAACAGAGCGACAGGCCGCACGTCGTGAAGCACCACAAATACGC
GCAACCATAGCACGGGAGGCAAGGGAAGTAGTCTTCTACAGTCTGATTGAGCACGTCGATACAAAACTTGAACTCTCTCCGAGAtactgcaagcagcaac
agcccaATAAAACACCACCGCAGTGAGATCATCTTCGACATGGTAACAGGGCGCAACAGGTGGAAGCTTCATCACTTACTGATCCCGTCTAGCGCGGTGG
GGAACACGTCGGCGTATGCTGAAGAATAGCCGCTCACTGTCTTCAACCCGGTGGCCTCCAGCCTGGCTAGCACCACGAGGTTATGGCCGTCGCCGGGCAC
CAGCCGCTCCGTGGACATTCGCCCCTGCAGCCTCAATGCTTATCAATCGGCGCCCCGATGCCTATCAAATGAGCGGGTGCCAGTGCCGCGAATCTTTCAC
CGAGCTCGAAAGGGCGCGaaccagcttcaacttggttcTTAGTAGGATCAAGTGTATTAGTTGCACGGCAAGTTGTCAAATTGCCGCTAGAGCTTTAGAG
CAGACGTGAGGTTGCATGGGCTGCTGTCGAAGTTAATTAAGAATCAGTGAGTCACTCTGCTAGgacagcttcagcactgACTTTTtactcttcttcgtct
tcttcgtcttcttcgtcacgaGTCGATGCTCACCACAGACCACTTCTGGACAGCCAAGCAATCACGCTGTTGGTTAGCCTGCATAGTCTCGATATCGATG
ACGAGCCTCAGTGCTATTTCCCTGTCATCAGGTACCCACCGCATTTCATCGAGGCTATCGGACTCCCACTGGAGGGGTGCGTAAAGCATGTCATCTGAGC
ACGTGATAGTCAGTTGGTTGAGCTGCACCAAACACCACACCAGTTAGTCGCTACAAGCAAACAAAACTATGATGTGGAGGGACTTACAAATTACCCTTCG
TCGAAGTGGGTTCCTCAACGAAGACAGCTGGGACTtcgttctcgagcagcaagttccacTCATCGTCTTGCCTCCGAGAACGTAGATCGTCACTCCTCTT
TTGCTGGTGTCTACGAGCTTGGTCTCCACCCAATTAATCGTCATACCGGAGGTCACGCCGACAATTTCCCCAGTTGCctcgtcaactgcagcgcacAACA
CTTTTCCTGCTTCAAGCTTCCCAAATttgtgtacatgtagatcCTCCCTCTCCAGTTCGCGTACCACACGTTGGTGATAACGTTTGCTGTAGCTTTTTCT
CGTCAAAGGTGAAAGTGGGCCCTGTCCTGGTAACGAGAGTGCTCGTGTCCTCTTGCTGGAATTCCAAGCGCTTGCGAGTCTTTCACGACACTTGTTCGCC
cgcctccagcgtcttgaacaTCTCACCACGTCTACAGCGTAGACACCCGCCAGTACAACAACCTTCTCCTGGATtatcttctccagcgctCTTTGACTTG
GATGTTCAGtaaggtggcggcggcatctCTTGTGACGCATCTGCTAGAAATGGCTTCAAGTGAgccagccaatcacagcggTGAAAAACGAGCATAGCCC
TTTTCCCCACAAGTTCGTTTCCAGCCATTGTGATTCGCTGGAAAATGATCTTCTTATTGACCAATTGCAGTGAGTTCGGCCTTTTTCTCGAATGTGCGAA
GGCGACTTCCTCTGGCCATACTCAAACCGAGACAACGGCCgagcagccaccaccaagtcgaagcgccaagtcgtcgcccgcttcctcttctcctcccagc
agcagcagccatgtCCACTGCCGCTCGTCGACGATTAATGCGCGACTtccgcaagctgcagaacgacCCTCCGTCGGGCGTGTCTGGCGCCCCCATGGAC
AACAACATCATGCTCTGGCAGGCCGTCATCTTCGGGTACGCACAGAGCACGCCAAAGCGTCGCCTTGAACCCTATGTATTCACTTGCGTTGCGTATTACG
ACTGTATTAGACCCGACGACACGCCCTGGGAAGGCGGCACCTTCAACCTGACGCTCGAGTTCAGCGAAGATTACCCCAACAAGGCTCCCACCGTCAAGTT
CATCACCAAAATGTTCCATCCCAACAGTAAGCTTTACCATTATTCGTCTTGTGTTATTGCAGTGACTAACGCAAGATTtatttgttgctgctgctgcact
gcagtcTACAACGACGGCCAGATCTGTCTGGACATTCTGCAGAACCAGTGGTCGCCCATCTACGACATCTCGGCCATCCTCACGTCcatccagtcgctgc
tgtgcgACCCCAACCCGAACTCGCCGGCCAACTCGGAGGCCGCGCGTCTCTTCCAGGAGAACCGACGGGAGTACAACCGTCGCGTGCGCGAGATCGTCGA
GCAGAGCTGGCAGGCGATCGCATAAACAGCTCGCTCGTCGGACGACATTGTACTACGCAGGTCTTCGCGAAGTGATGTGGGGGTGTAAGCAGGAGCGGAG
TGCCTGCCATTCTTGTCGATGCGTTGCCTCTCTattcttctttttctccCGCTCCAAGCCGACTGTAGACCCAGAGCAGAGATTGCGTCGTGCATGACGT
CATGCAACGCATTCTACAGACCGCGAACGATGATACGAAGATGTTAGGTGGGCAACAAGACAATGCGagactggagaagcaggacaGTTACGAGGACAGC
AAACTAGGTCGGAATAGCAGGTGCATGGGTACGAGAAACTTGAATGAGAACAAGAGTAATTTCTCTTTGGCTTGTTAGGTTGTTATCGTGCTTTACTGGG
TGAACggtgcttctgcagcttcctctACACTGTTGAGCAACTGGTTCGACTGAGCTTGAACTGGGTTGAAGCAAGGATTGATCGTGGGCGCTTTGACTGA
CCCAGACGCAGaagcagaggcagcagcagctccgaagGAGGACAACTGAATATCGCATCCCAGGTCGCGTAACGCTGCGTAGGCTTCGTCTCCGCAGCCA
CGATAATGTTGTGCCTCGCGAAGCAATGGCTCGATCTCGGGTTCGTCATGCAGAAAGCGTGAACGCAGCTCCACATTGCGTGCCACCATGTTACGCACCG
CTAGACTTGCTTGACGCAAAACAGCAACGTCACGGCGGTGAGCCTGCATGGCCCGCGAGATTTGCCGGACTGCTCCAAGCTCGACTAGCGCACGACTGTT
CTCTGGAGAGCGCAGTGCAATAGCAGCTAGCGTAGCACACGCGTTTTGTTGGATCGATGCGTCAGCTTCATGGCGCTTCATTATCAGCAGAGTCCGCGCA
ACACCTCCAGATTGAAGAATAGCACGCTTCAgatcatctgctgctgctacattCCGGAAAACTGTAATGCAGCGTTTGGCCACAGGTGCGCTGTGTTCGT
AAGCTTGCATAACTTCTTGCACAGCGGTTAATCCATCCAGATCGGCAATCTGTTTGCagttctcctccgtcacggcAAGCTGTTTGAGCACTGCAAGCCA
ATTGACCAGCAACTCCGGCGACATGCTTGACacgtgcgctgctgcttcactgCGACCAATTTTACGGAGCACTACTAAACTATACGGGATCACACCACGT
TCAACGAGAGCTTTGATGGTATCTTGAGCCTGAGAGAACGTCGCGTTGGGGTCGTCGTTGATTGTGAGCACACGGAAGCACAGCGCCAATTGCTTCGACA
GCATTTCGTTGTCCCTCGCTCTGTCTAAATGTCCACACAACGCCTCAACTCCTCCGGACTTGGTAAAATGTGCCTTATTGCTCTCGTGCTTGACGCAAGC
TGCCTTGACCAGTGCCAGAACTCGCACCACaacctccacctcctccaattGCCGCTCTAACATCCCCACAAATCGCTGCATTCCTGCAATGCCAACAAAA
TCCTGATTGTCCACATTGTCTGCACACAGCAACGACAATAAATTGCAGCAAGCCACCGTCACAGCGGCGGAATCCGCGTCCAGCAGAGCCAATAACGTGT
CCACTGCATTGTTCCGTCCTGCCACCACACGAGCCTCCGAAACCTCCTCGCAAACGCTCTGCAGCTCAGCAACAAGGCTCAGTACTCGATCCTGCTCGTT
CTTGCGCCtggaaagctgctgcagctccgagacCATCCGCTTCAGTCGTGCAGACAGCGGCTCCTGCCCCTCGGACGTCTGTGCTGAGCCGCTCTTGATG
ATGTTGGACAGGTCTACGCCCTGcgactcgaactgctgcacggcgtcggccaccgcctcctccagcgacatGTCGAACTCCTCCACATTCTCGGCCACGC
ACTCGTCGAACGTCTCCTGCGATATCTGCCTACGCGCGGCCATCTTGGTCCAAAAAGACTCGAAATGTAGCCAAGTCGACTGAATCTAAAAGATATGTTT
ATAGGTATATCTATAGTATTGAAACAATAGAAGATCGGATCAGCAAAAAGATGAAGGCGGACGTTAACGctgatgagctgctggttgaggGCGTGGAGTC
TCTGGAGGAGTATTTAAACGACCACGAGATTGCGTGCACCAAGCTTAAGCAGGTGAAATTGCTGTTACATTCAGTTCATTTGCACATCAGCAGAATTAAC
GGCGTTTTGAGGGCATTTGTGCAGGGATTTTTGATGCTGACGAAGGCCAAACTGCGGCTACCGGAGCATGCACTGACGGAGATCTCGTACCACGAGGAAT
TTGAAGCGTCCCGTGTGATAACACTAGATTCCGAGGGAAACTGGCGGCTGCAAGATGCATCAGAGGCGAAGGTAGAGAAGATTGGAGATAAGAGTGGAGG
CACGGCGCTGCATCATCGGAGAGCAGGCGAGAACAAACAGGACGGCGGACCGACCAGCGCAGGGAGCAACAATTCACGTTCGAGTACAGACACACTGCTG
TGGTTCAGTTCGTTGCCGCCGAGTGACCTCCGTCACGCGCAGAAACAGTTTTCAAGCGGTAAGTTGACGGATCTGCAACTTGTTGGGAGGTCAATTACAT
TATGAGTTGACCCATGTGCTTTCCTTCGCAGGGTTGCAAGCATTGCTAGTGGCAGCAAAGTCAGCGCAAAAGGTTCAGCGAGCTGTTCGTGGAGTCAATG
AACATTCGCACTAATACGATACGTCAAAGAGTGTGGATGTTAAAGTGCATACGAGTTGGAGTCGCTCTATAGTATGGGTACTCCGCTTGTACTTTGCTAC
ATGTCAGCCCTTACACAgactgccgctgctggtaACCATCAGATTTCCGCGAGAAGATACCTGTGAACCGCTGCCTCATCTTGTCCATCGCCATTTCGAA
CTTGATGCCTGTTTCCTTCATGAAGGGTACGTTCATCTCTTTCCCCGTGTAGCCGCGCTGCAGGTTACGACGGATGAACGTGTCGTACTCCGCGATGATA
CGGATGATCAGATCCGAAGTCGAGATGCCATCGGTGCGTTGAGTTTCGTGAAACTTGCCCATTGCCTTGATCCGTGCATACACGTCGccctctgcagctt
caccggAGGAATCTGAGTACGGCAGTGCATCGTGACAAACGTAGTCGATCTTGTGTTTCTCAATGAAGTCATCGGGGATCACCCAGGGCGCGTCCTCAAC
CACTTCGTCCACCCACTTGCAATGACGCAGAGACTCGTAGCGCTCCTTGTCCGTCATGACTGTGCGGCCCTTGAGTTTGTGGGTGATctcatcgctgcag
cagcccacGATCAGATACGTGTTGGGGTAGGCTTCCTTGCACTGTTGCAGAGCTTTCGCATGGCCGAAGTGGAAGAGGTCGAAGATGCCGTCGGCATAGA
GACGCAGGGGACGGCCTGTTAGAGACCCAGGTTCACCTTCCACCACTGTTTTGCGCGACGGACcggagctgcacgaggtAGACTCGGTGTTTGTTGCACT
AGGTCCTTCAGTGCTTGCTGGCAGACTCAATGAGATTTCATTCTCGGGCTCGTTGTTGATATCGTTTGGTGTCTGCAAGACCAAATACAATGTAAGAAAC
TCAACAGAGACGATCGACGCGACAGGGTAAAGACGAAAAACGTACCGGAGCCATGCTCTAGTGTAGTGAGCTTCTGGTCTCGTGTGTGTGTTACCGGGAG
AAATCTGGAGTGACCTCATGGGGCCGTCACCTTCATCGCTGCGACGAGATGGCGGGGTTCGCGACAGCCCGTCCTGTTCAGTTTCGCATTGGCCGTTGGG
TGGCAGAGGAAGCTTCCGACGTCCATCGTCCTCGACTTTGGTTCTTGTTCAACACATTGCTGagtgcaccacaccacatTTCATCGCTAAGTGCGCTGCG
CACTTAACACTTCTTCGATGACGATCGGCCACGTCGTGCAGCCTGGCGAGGGCAGCGTGCTCGTAGCGCGGCTTGCTAGCCGCCACTTCCGGCCTGGGAG
CGTCGTCAAGGGCGTCGTGCGTCTCGTAAGCCACCAGCAGAAACCTGACGCGCAGTCGGAGATCGCCCATGTGGTGGCACAAGTCCACGGCCACGTCACA
GTTGACAGCAATCTGCTGACGATGCCTGTAGTGCACGTGGTGTCGCCCCGCGCTGCGTCCCAAGAGGAGCGAGAGCAGCTGGAACGTAAACTGTCAGAGG
ACGTCATACTGTTCGACAAGATGGGCGCAGCGCTGCCTGATGTGCGCCACTTCTCGGGGGACACAGGCACGTGCATCTTCCGCTCGGCtccgtcggtgct
gctctcggaTATCAACATCGCACCAACgcagtcggagctggaggctgccGCTGCAAAGAGCCACGGAGCTATCGACCTGGTGTCTACAGCTGAAGTAGCA
CGGGAGGAGACGGCGGAACGCTGTACGAGGGAGTTCGCCATTGCACTGCCAAAGAACATCTGCCCAACTTTCCGTGGCTCGTCCGCTAGAGTCTTCTACG
TGGTCTCCATCACGGCGCAATGTGCGATCGCAGGCAGCAAACCAGTTTCGGTGCATCTACCATTTGAAGTTTACGGCTCCGAGTATTTCTTCGAGGCAGG
AACAGTGGCGAGTGCCAGCCAACTCGCGGGGAGTCAGGGTACGAGTGCGTCTGCTGGCAAGGGTGCGGAGAGCGCACCGAAGAAGCAACAAGAGCATGTG
GTGGGCGGAACTACTCGCGTCGGACGCGGTGTGTCGTTGGCACCCGCCCCAGTTGGAGTGCGCAAGGGCAGCGAGATCGCGTTTGAGCTGCGGCCTTCGC
TCATGCATGGCCGCGTGGAAACGGAGCTGATGCAACGCGCACAGACAAGCATCTTCACGATCGGCAAGGACAGCAGCCACCTCGTGCGGTTCCTGCTCAC
CAAGCAGTTCTACCAGCCGGGAGAGGCTCTCCTGGGGGTCTTCGACTTCACTCGTGCCAGTATCCCGTGCTACGAGGTGTCGGCGACGCTGTGTCTAGAG
GAGACACTGTCATCCATGGCGTTGGACCCGGATCGCATCGTACAGTCCAAGGTCTTCGGCAGCTTTCATGAACGCACACTGggcgtgctgcagaccaaCG
TGCGCTTCAATATCCCACACGATGCGCTACCGACCATCAAGACAGACCTGGTGCGCTTCCAGTGGCTGATGCGCTTCGAGTTTTCGGCAGGTGCACCACC
CCAACAGCAGGGAGATTCCAGCAGTGGCGCAGCAACCTCGCAGCGACAGACGTTCCAGTGGCAAGTGCCGATTGTCGTGCAACCCGCAGTAGCCACCGAG
CGCAACCAGCTCGCCAATGTGCCGCACAAACTCTACTCGGGCAGCACACGCGTGGCATCGCTGtctggatgaagttgaagcgcgTCACATCCCAATTAGC
CCATTCCTGAAGCCTACGGTCTCTAATATAATGTACCGGATTACTGTGTCATCGGAGTTTTGCTCCCTCCACACCGCTAGGTCGATTATGACAGCCCAAA
TCAGACAAGAAGCATTGCCAATTGTCAACCACAATAAAAGGGCGGCGCGTCACATTTTCGAAATGGGTTCGCTCGGACTTAATAGATTGGATACGGTACT
GTCGTGGTTCGTTAAAGTACGAGCGATAAACGATACACAATTTTCGCACGTGGCACTGTCAGTTTTCGACCAGGGAGAGCGAGATGGCGAGAAAGGTGCG
AGTTCGTCCCCCCTGCAGCTCCCCGTGTTGGAACTCCATGCGTTTCTGCTTCGAGCGACCCAAAGATCGTCGTCTGGACGCGTTGGGACCTCTTGAAAAA
TGGCTgtggagctgatggagacTTTGTTGATGTCATGTAGAGACGTGCCACCGAGATGAACAACGCGGAGGAGGCTGAGGCCGACCACCACGCGCCTGCT
GAGGAAACGAAGCCGACGTCTGAAGACGCTAAAGAGGTGaacgacgtcagcagcaccagcagccaaGACGGTGAAGCCGAACCGCAGCCTGAGCCCTACC
GCAAGAAACTGAAAGAGGGCGAGCCTGGCACTTTGACTGGCCGTCCCCTGCGTCTCTATGCCGACGGCATCTTCGACCTCTTCCACTTCGGCCATGCGAA
AGCTCTGCAACAGTGCAAGGAAGCCTACCCCAACACGTATCTGATCgtgggctgctgcagcgatgagATCACCCACAAACTCAAGGGCCGCACAGTCATG
ACGGACAAGGAGCGCTACGAGTCTCTGCGTCATTGCAAGTGGGTGGACGAAGTGGTTGAGGACGCGCCCTGGGTGATCACCGATGACTTCATTGAGAAAC
ACAAGATCGACTACGTTTGTCACGATGCACTGCCGTACTCAGATTCCTccggtgaagctgcagagggCGACGTGTACGCTCGTATTAAGGCGATGGGAAA
GTTTTTGGAGACGCGACGTACCGATGGCATCTCGACTTCGGATCTGATCATCCGTATCATCGCGGAGTATGACACGTTCATCCGTCGTAACCTGCAGCGT
GGATACTCGGGGAAAGACATGAACGTGCCGttcatcaaggagaagagcATTAAGTTTGACATGGCAGTAGACAAGGTGAAAAATGACGTCGACGGATTCG
TGCACAAGTGGATGAGCAAGGCCGATGACATGCAGCACAGTTTCCTGGAGCTTTTCAGCAAGGAAGGCCCCCTGGTACGTTTAAGGGCTTCCTGTCGATG
CATTGCGTTGCTGGATATTCTAACATTGTTTACGAACGCGATATTATTCATGCTAAACAGCGCACATCATTCCGCAAACGCCGAAAGATCCTCAAGGAGC
GGTTGTCGGAGCGCATGTCCGAGATGGCGCGCGAAGGACTATGCTAAAACTAGCAGAAACGGGTATCTCGAGGTCTTTGCTGCACGCACATGGGCATTTA
GAGGAAGCGTTAGCTGAGGTCTGCAGAACCGTGTAGGTCTTTGGCTTCATCTTGATTCGTATGACAACGATTAACCACCCAAGAAATGATAAGACATGCT
TTTCTCGCTATGTGAACCCGTGTTGCTTCATTCCATGAGTTGCGACGTTGAGAACGACGCGAACTTTACCTGCAGATGTGACTCGTGTTACCTCGCGACT
GTCGCTCTGCGCCACGAACTTGGAGTCGAAGTATTCCGGTGGCGATCCGGTTAGCCACGCCACAAACTGCTGtatcatcgacgacgacatcggtCGAAAC
AGCGGCACTTCGCGCACCGAGCACCCTGGGGTCACTGGGAATGCAACAGAGCCGTAACCTCGCACCACATCTCGGCCAAATGTGTCCAGTCCGTACAGAC
TAAGCACCAATCGCGGCCAGCCAAATGGATTGGTGCTCTTGAACGACACGTCAATGGGAAAGTTAAGCAGGATCTCGTCTTCATGGCTGGCCAGGTACGC
AATCTGCGAGAGTCCGTTCTCGGCTCCCTACAGTGCAAAATGCCGTCGTAAGTCGCCCCAATGAAATCAACCAAAGCATGTCTGCAGACTCACATGAAGC
ACGCGCCAGTCGACGCCATACGTGATGCCATATCGACAGTACACATTGCTAACACCGGGGTACTAGCATCAGCAACACTTTAGAGATCATGTTCATTTCC
CCATCAATGCAAAACTACAACAGCTAAGGTGgtcgtacatgtacactCTCCACTTGACCCGAGCAGATGACCTGGAACCCCGCAGCAGGTTGTACCGCCG
GCATGGACGTTGGTATGggcgccactgctgctgcagcgtcgccatgatCTCCAACCAAAGATTTCCTCAGTCTCAGccgctccagcgccttggccactgc
gtcgtcagctccagcatggGGAGATGCCATtgtcttcaactgcttcaactttCGCGTCGCTTCAAGTCAAGCGCACCGTAAGCGCAACATATGGATGTTA
TgttgcaacagcaacatacAGTACGTCCCCTTCTAAAAAGCGAGGAGAGCCAAGCGATGGCCGATCGGACCGAGTCGGCGGACGAGCGCGCCCTGCgtcg
cgagctgcaggaggtggccaagaagcgccagGCGCTCGACAACTCAAGTACGCTAATATCCCCTCTCTTATGGGCTTTATTGTCCTTTAGACGCCTCTGA
TCAGCTGGTTTTGACCATTTCTTGCGTGGCGATCTTTAATCGAATTGCTTTATTGTGCACTTCCGTGTTTACAGAGCGTCGAGGCAGCGGGACAGCAGCT
ATAGGAGGAACAAATCGACGGGGTAGTGTATTTTCCCGGCTGGGGAGCGATTCGGCTCGTGCAGGAGGCGCAAACCGACACTTCGTTCAGCTGAAGGAGA
ATACTCCTAGAAGCAATGCATCGAGGAGACTGGGAAAGCGCGAgagtggagaagatgatcaCCATAGCAACACAGTGAAGAGACAGAGACTGCACTCGGC
AGTGTCCAG