Description :
From Genome Similarity Track
Location :
Scaffold_3:360209- 361336
Transcript NameFunction/comments
Physo_492190ring domain protein

Sequence
1127 bases(100 bases per row)
AGTCTACATAGTACGTTTTGCTGATCGTGTTTGTTGCATTGGGCCACAGATGTTTGAGCTGCGCAAGCTAATTCGGAGGCGTTTGAAGCTACCAGACGAG
GTACAACTGGAGATGGCGTGCATGGGTGCCACTGTGGGGCCTGAGCTCTCGGTACATTTCATTCAGCGAACAATCTGGCAGCATCAGAACCAGAAAGAAC
CGCTTGTGTTGCACTATCGACGCATGACGTCATGATAGTTTCGCGACGGATCTTAGCGTCTGAGAGGGTCATGTCTGTGGAGAGATTTATAGTTGTTGCA
GGGCTACAGTCATTAGACTGGCAATGGAAAGTTGTGGGCTAATACGACAACAACAGTTTTGTAGAATTGCACAAATTGATATGTGTTCTTGCTGGTGACC
ACCGTAAGCCTACGAAGCGTTTTCCTGCATTTGAGCGGGGTGTTTTTCAAGTATCAGCTGAACGAGCTGCGGATATCCACTGAAGTATGCCATCGAGAGC
ACGGTCCAGCCGAAATAATCAACCACGTCCACGTTCGCCCCATGGTCTAAAAGGATTCGAAGTGGCTCGAGGCGGTTGTACATTGCCGCTATGATCAGAG
CTGTCGAGCCGAGGTCGGACTGCTTGTTTGGGTCGGCGCCTTTGTAGACTAAGAACTGCACGATCTTGTTGTAGCCCTTCTTCGCAGCAATGAACAATGG
TGTAGTGAGGTCCTCACTCGGTTCATCAATCTGTGCCCCAGCTTCGACTAGCACTTTCACAACCTCCAAGTGTCCGTATTCCGCCGCAATTCGCAACGCA
GTAGCCTTTTGTGGCCCCCGAGTATCAATCTCAGCTTCGCACTCAAGTAGAAGGCGGACAGTTCTCGTATGTCCGCTCACGACTGCGCGCATGAGGGGGC
TCCAGCCCTCGAAGTCGGCCACATTCACCATCGCCCCTCCCCGGACAAGCGTGGCTGCTATTTCATTTAAACCCAACTGACACGCTAGCCCCAGGGCTGT
GCTGCCATTCTGTTCTGCTGGAATGTCAAGGGATGCCCCGCACTCAACGAGAAGCTTCACCATACGCGGATGGTTCTTTATCGTGGCAACGTGAAGTGGT
GTGTAGCTGTCAAATCCAGGAGTGTCG