Description :
From Genome Similarity Track
Location :
Scaffold_652:3602- 8806
Sequence
5204 bases(100 bases per row)
GACATGTCCAAACGAGTGCCAAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGTAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCAT
GTTGGCGAAAGACTCGGTCTAAAAACCAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAGATGAGTCATCTTGCTCAATCGGTCTA
CAAAGACTACAATACCCGTGTTTCCTACCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTGGGGACAGGCAAACT
CGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCAGCCCACTTATACATCTTGGGCCACCAG
TACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTCTAGATCCTCAT
AATGAGGAACGATTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAAGCGCCC
AGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCTCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCA
GGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCA
CCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTTTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAA
GATCACGAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCT
GCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTGAC
AGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTT
CCAGCACCATGGCGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTATTTGTGCAAGTAATTGGCTAAGCCTAGC
CACTTGCGTAAGTCCTTTTGGTTCTTGGGAACAGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCTTAAGCCTCACTTCCCAATGAAGCACC
CGAGGAAAGGTATTTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAAT
GTGGTTTTCCACGTCTGACTTTCCGTGCTCAGCACGACTATGGACGAATATATCGTCAAAGTACGTTTGATCGTACGCCCGGTGGGGCCTAAGCAACTGC
GTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATCACCAGCCACTCGCAGAGCATACCGCTCGGAGTACTCACCGGTGTCAGCG
GAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAACATCCTT
GCCAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAACGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTG
GGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCC
ATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCAGAGGCAGGCCCGTCGGTGGGTCTTTCGAGACAAC
GTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTCTAGG
ACCGCGTCGTCCACGACGGATGAGGAGTTCAACTCCTCCTCAGGTCCCAGCAAGACCACCTCGGCTAGCTCGCCTGCCTTATGGGCTTCGCCAAACTCGG
CAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGTGTCAAGGCTGATATCGCCTTCTACCTCCCCCGTCACTCCGTTTACGAGTGT
ATACAACTGCTCACATCAATCACGTGAAGCATCACCGCTCGTCACGTTGGACACATCGTCCGACGTCGAAGACGTCACAGACGCCCTGCGTCTTCTTCTC
CTCTCCCTCCGCGACCGAGCCCGGCCGGATGAGGGCGGTGTGGCAACATCTCCGTCACCACCACCGGGTGCAGCAGCACCATCACTCCTCGAAGAGGATA
CAGTGTCTCGCAAGACACTCGGCTGAAAGCTAAGAGGTTCTTGACCTTCACACAGTGAACTAGGTGTCACTTCACCTGCATCTCCTGGGCCACGCCCATG
ATGCCTCGACTCGCAGTCGATCGCGACCCTCGGGTCACGCAGCGGTAGGCCATCGACCAGATTCATACCACTCAGTGGATTACGCGCCACTCCGCGCTCG
TCCTCACCAGGACCCAGCAGTTGGTCATTGACCTGACCTGCACCGCTCAGCGGATAACGTGCCGCACCACGTACGCCCTTAGGGCAAACAGCAACCTCGT
TGCTAACAATTTCGGACATACCAATGTCCAGCACTACGGCCGCCTCGGCCTCGTGCTCGCGCCAAACGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCATG
ACTCACCAAAGCTCCACTAGGAGCAGGGTGCGACGCACCCAGCGTTTTCGACTTCCAGTCGATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCAAGG
ATGAGGTCATACCTCGCATCCAGGTCTAAGACCAAGCAGCGTTCCACGCTATCGAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAG
TTACCAGTGTCCCCGTCGCGAGACGGACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCCTCAGCATACAGCTGACTCCCTTCTAGGGTGGAGCGACG
GGCGTAGTTGCCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCCCGGCTTGCACACA
CTCTTCTCGTAAGAGAGCTCAGCTCTCTTCGGGGCTGAGCCCCGTTGCCCTCTACCTCCTCGAGGTACAACAGAACTCAGTTCTTCCCCCGTAGGCCGCC
CCGCGCCTACTGGGAAATGCCGTTTCCCGGCGATGACCCGGAGGGTTGGCTCGCCGGAGCCCCGCGCTTCTTGCGCAGAGGGCAATATGCCCTCAAGTGC
TTAGTGCTATTGCACACAAAGCATCGGCGGATGCCGGCACGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGGCT
CTGGACCGCTCGAAGAGCTTGCGCTACTAGCGCTCCAACCAGGTCGATCCGACCTGAAGTTGTCCTCGGCATTTAATGCCACATTCACCGCCTCTTCGAA
AGAGTTAGGGTGTACACGGAACACTTCCGTTCGAGCTGCGCTCACACGAAGTCCCTCCATGAACACGGTCACGCTGACCAAATCCGGAAGAGGGTCCGCC
GCCATTCCGGCGATAAGAGTTCTCAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTTTGACCGGATACGGTACGCCT
GATTAGGCGGCGCAAACACGCGCGAAAGCTGTTGCTTCAGCTGATCCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCCATTTGCG
AGCGCGACCTCCACGCCTGGAGATAGCCAGCGCCACGCGCTGATGCTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTCCAGAGA
AGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCCGTTG
CGGCGCTCATCTTCTCTTGGACATGCTCCAAGAGCGCGTTCTCGTAGCGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGATGCAAG
ATGAGCCACGCCCTCCGGGCCAAGCAAGGACATAAGCTTAGTAAGCGCGTCCTGCTGCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCA
GAGGATATAGTCAACCGACCCAGGAGTGAGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTC
AAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCACGACCAGGGCTCAAAGTTAATACCTTAATTTTTATGCTTCAAAACCAGAAG
TGTTTTTTTTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTGTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACATGTGGC
TTTCGGCCAACGTACTGAGAGACCTTGTTAGCTCTCCGACTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCCACACCA
TGTGACCCCGTTACAATTTGACTCCGCAGGCAGCGGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAACCG
ATCCACTTCCGCGGGTTCGTTCGCCCCTGGATCCACTTGGAAGTCGTCAATCGTGACCTCCCCTGTGGTCAGTGGTACCTCCGGAATCACCGCCAGGCCT
TCTCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACGTACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACC
CTCT