Description :
From Genome Similarity Track
Location :
Scaffold_33:360082- 363439
Transcript NameFunction/comments
Phyci_65238Hypothetical protein
Phyci_221983Hypothetical protein
Phyci_161787Hypothetical protein

Sequence
3357 bases(100 bases per row)
aatacttgagaactgtgattctgcaagatgccgtattgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGACCGTGATGCCCAATATGTCGTACCCG
GCATTGGGAAGACTtctttcactcgaacaaattcaccttaactcgaacggattcaccttaactcgaacgaTGCAAAAACCTCAAACTCATCATACGTCAA
ATAGCCAGTTGATCTCCTCTCATCCATCACTTCGGATTCCCCCCTCCAGCCGACATATACCTCCAAGGCCGACGATGGTGCGCTCCTGCAATAACCTCAC
GCTGGAGGAGAAGATAGCCAAGCTACAGCGGTGGAAACAACACCCTGAATGGAGTCTCAAAGTGGCGTCTGAGGAGTTGAATGTCCCCAAAGGATCACTG
CACGGATGAAAAAAAAAAGTTTTGGCATCTGCTGGACCAAGAAATTCCTGCTGACGTTGCTCAAAGAAAGCGCAAGAAGAGAGCGGGGCGTCCACACCGA
TTAGCCCCTTACGAACTACGCGTGCTGGAGTACTATGAGAACTGTATAAATCACGACGAAAAGTGCAGCAACATCGACTTGCAGAAGTACTGCCGTGGAA
TTGAGGAGTTTGTGAGAGCCAAGTCTGACAGCGACCAAAAGACATGGGTTCAACGATTTGTTGTGAGATACAAGGCTATTGTTGCAGCGCGGGTCAAGGA
AACAAAAGCAGCTGGAAAGGCTGCTGCAGACGCAACGGCTGCTGAGAATACAGAGGATGTGGAGGCTGCAGAGACCAGAACACGTACACTGACAggcagt
agtgacagtgctgagggtagcagtgacgctgctaagggtggtggtgacagtgtttgcagtggtgacagtgatgacagtgatagcagtgAATGTGAACCTG
ACGAAACTAGTGGTAGCAGGAAAATTGATCAAGCTGATGAGCCTGGAAGTCGGCCGCCAGCGGCCGACAGTGAGAGCGACGTGGAGATGCTGGACAGTGA
TGTGGGTATTCAAAAGAGTGGTATTGCGGCTGCTATCGCAAAACAaaatacgcaaagtgctacaatgcaacgtttttttcgaacgcgttatccgagcTAC
GCCCCACTTGTTGTGTGGACAGATCCACAGACAAAGATTACGCTACATGTATTCATGGACGACTCCGATAGTCTTCTGAATAGTACGGCGactactggaa
acgcaattgactatttcatctacaggtatatgatgaataaaccaggcattgtttgcgcgcttggaactgctgtattcgctgaaatggaactggcattAAC
TTTTCGGGGACGCGGCAAGAAAAAGCAACAGTGCTCAAGTCGTTGATGGAGGGTTTTGATTGGTCTGCATATCGATATGTTCTCATCCCGCTTTCAGGCA
GAAATCACTGGAGTTTTCTAATTGTTGAGAATGCAGCAGAAAATGGGCATTGCAAGATGTATCCTGTTGATTCTCTGAAAGGCACACACAATTCTGATCA
CGTTTTTCAGGTATTCAAGTGGTTTCTCAGTCACCGCTTGGCTTATAATACAAACCTCCCTGTTGCAGGATTTGAAGCTACAACCTACGCGTACAAGACA
AAGCCGCAGCAAACTAATTCGCTTGATTGCGGTATCTATCTCTTGCACTACATGGACACTATTGCAAGTTTGATTTCTGAGCTTGTGCCTGCATCCATTG
TGGATGACATCACGTCCTGGACAACCCGCGGTAggtttaatgcgacgaaggccgagcagtatcgcgctcttctccaccagcgatttcacgaggacatgaa
accacggtagtttgcttTCTTTTTCGTCtgttcgagttaaggtgaatctgtttgagttaaggtgaatctgttcgACTTACTATGAATCTCCCCTCGATTG
GATAAAATTTCTGAAAAAAGATATTTGCCCCGCGTCTTTTCCGCATTACAAATCATCTTAGGTCCGGGACCGAGACCCACACTAAGCCAGGGTAGATAAC
CCCTAattatcggaagtgaaagagcgcgccgtccccctcctcgtccccgtcccgtcgccgtgccgtctctctgataactcagttatcagaagtgtcaccc
tctgaataacagcTGCTATCTTAAAATTTAGCACATTTTTAACCCCAATATTGTCATTCGCGAAAAAGACGGGAGGCGACGAAGAGCCCCGCGCGCGGCG
GTGCAGGCCGGCACCAGCGGGCCAGGAGGAGAGGCTGCGGCGACGAGGAGGTGATGGCCTCGCGCGCGGCGGTGCAGACCGGCACCAGCGGGCCAGGAGG
AGAGGCTGTGGCGACGAGGAGATGATGGCCTCGCGCGCAGCGGTGCAGATGAGCATGTAAGTCTCCATTGAGCGTGAATATAGTTCGGCGACAAGTGTAC
TAACGCTACAGTGTATGTGTGGCCTAGGTCTCTCTACCTTTTAGActctcactcaatgcgttcaacgttaagtgcgattgtgttctgtgattctccagca
tgcatactgcttgctcataagtgacgtgttgctgttgtgccatcaggataactcggtcaattatacgttttctgcggaaaaagaatcgcttttcggctgc
gttgctgcgccagctcgatccaagttgctcttcaagtttacgcacggcagggcccccatttattccgacctcccattcctgccacacgtggtgcacagtc
ttgatggatctgaggagcttgtacgAAGCTGGAAGTGGTGTGCGACGCGGATGCGTT