Description :
From Genome Similarity Track
Location :
Scaffold_37:36006- 54671
Transcript NameFunction/comments
Phyke_g2197hypothetical protein PHYSODRAFT_358438
Phyke_g2198hypothetical protein PHYSODRAFT_309148
Phyke_g2199conserved hypothetical protein
Phyke_g2200hypothetical protein
Phyke_g2201hypothetical protein PHYSODRAFT_343769
Phyke_g2202acetolactate synthase small subunit, putative
Phyke_g2203family 3 putative glycosyl hydrolase

Sequence
18665 bases(100 bases per row)
TCATGCGTCCTCACTGTCTTCATTTTCCCAAAGCGGATGCGTTAACGGTTTAACACCTGCACGTTGAAGCATTTGAACGGCTGCCTTTTCGATGCGTTGC
AGCTGTCTATTCACCAAACTCTCACTCTCAGGTGTAAATTGCTCCGTTCGAATTGTCAATAATCCTGTACAAACACCAAAGATCAAAGACGCGTCACAAC
ACACATTCATGATCGATTCAATGAATTACCACCGTACCGTTAAGGTTGCCAAACAGCACATCTGTCGAGTACCGATCACCAATTATGATAAGCGTGGCTG
GATCTACATCACCGAagtgcttcttcacgaacgcGGCACCTCCAGGTTTCTGCAACAAACACATACGCCTGTCAGAGCCCCAAGCTCCACCCAATATCGC
AACCAACGCTCCCCCAGTACCTTTTGATTGTGTCGAAGGACAGGTACCTGAAGCTCGTCTTCAATGCGCTTGGCCTCTACGCCGTCCTTGTCATCTGTGG
AGCCTGCCGAGttggagaagatgacaacGCCAGTATCGCCGAAAACACGGCGACATTCGGCCAGAGAACCCGCTAAATGAGGTGCAATCTCCAGTCGATG
GGGTACTGTGAGTGTGTTATCCTTGTCGAAGATAACGGCACGAAACCCGCGGTCTTGGAGCTTTTGGAAGGGGATTTCCGTCACATCTAAAAGAGGAGCA
TAGGGTTTTAGTTTGTAAATTGTGCAGGCTGTAGATGTCATATCAATGAAATTTCTGGATAGCCGGATAGAAGACACCAAGAACTATACCTTTGACGGAG
ATATGCGGCAGTAGAAGCTGCGGTTGGTGCGTCAGCACGCGGCAGAATTCCACCACGCCGCCCAGGTTGAGTCCCTTCATGGTCTTGGTCAATATGCGGT
CTCCAATTCTAGCCAATCCCGTGCATCATTCCTTCCATTCGTCTCTATGATTCGTTGATAATCCCAATTATCTTCCAATCACAGCACGAAACGGCTTGCG
ACAGCCAGTGACGAGCTCAGTATTATCTCCTCGTACTACGCACATCGTGAGTCTGGACTGGAGTCTCGTTCGCTCTTACACGGGCTCCGAGTACGACCAC
ACTCGCTACAACATCGCCACCCTCCATCTCAGGAATCTTCTGAACATCGAACCAGTCGCTTAACTCGAAATGGCTGATATCCCACAAGAAACGCGCGTcc
aggaggaggaagaggacaaggccaagagctccagttccgacgacgactcgtcgtcctccagctccgggtcctcctcctcatcttcgtcgtccgaTTCCGA
GTCGGAGAACGAAGCGGAGGCGGAGAATGGATCCTCCAGCActgctgacgctgccacACACGCCTCGCCTCGCTTAGGAGGTCGATCAGGTCCCCCCCAC
GCTGCTAATGCTTCAGGACCGGCGCTGTCTGCGCCTCGACCACATGGCATGGCTGCCAATAAAGAAACTCTTAATGTAAATTCCACTCGAGCTGTGGCTC
GCTTCCGTGCTGCAGAGGAACGCAATGCGACCCAAGCACTCATGCCACTGGGCACACGCAAGCGAGATCGACGCACGATTGAAGAGATCCAGCGCGATCT
CAGGgacaagcgcaagaaacCGCTGTCCTCGGGGACGCCGGCGGCGCGATCCAGTCCACCACCGCGAGGGTCACCCGTGCGCTCCCCTGAAGCTGAGGCA
GTGGTGAATAGTGGCGCACCGATGGCTGTGGGTGGTCCACTTGGGACtttcggagctgctggacgcctTCCAGTCAAACGGAAGCCTGTGTCTGCTCATG
ATAGATTAGCGATGAAGCTTAACGGACGCAAGACAACTAGTGCaaaggccaagaaggcccCAAGCTCTTCTACTAGTGGAGGTGCGAATGTGCCACCAGT
GTCGGTGATGACAAATAAAAGCGTGACGAGACCGATGACTGCAAcgagctcagcaacaacaggaaacagcagcagcagcgaccaTGGTGGCGATACTGGA
GGTGATGGtcttagcagcagcagtagcaagCCGGTTTTGCCGGTGGTGACGGATGGCAAGGCGGTTCGTGCGGTATTGCGCTCTATGCTTCGCTACGGAG
ACCTCACAGACATAGACCTCTATTCGTCTGCTGCAAATTTTGCTGATGAGTACAAGATGCCGAGTTTTGTGGAGCGGGCGAATCTTCAGGCTTCGACTAA
AATGTCTATTGATCAGCTACTTAATCTCGCTAAAGATGTGGCGCAACGCGCCAAACAAGCAGTGGAGGCTCGACCACCACATGACAACATTAAGATCTTT
GAGGTCGAGGCAAGAGCCTCGCAAATTATTGAGCGACTCTACGAGAACTTGAAGCTTCGTGTTGCCGTTCAGCGCGCGCTACGTACTGCCGGCTGTTCAT
CAGGTAACGCACAGGCGAATGCTCAAGGAGCTTACGTTTTGGTTGCCAAGCAGAGTGACCTGGCTGTTCTGGGTGTCCATACGCGAGACTTACCCAGCTG
GACCTGGGCTGAGAAAGAGCACGACTGGTCGCAGCGCAAGGATGCCGCATTACTACTTGGCGTCTACGTTCATGGCTTCGGTGGTTGGGAAGACATTCTT
AACGACGACTTGCTCCATTTCCAGGGACAGAGAGCTCTAAAGGGTGAGCGCTTGAAAAAACGCGCTGAGAACCTTCTGAAGCGATTGCCTGCGCCCGACC
TGGATGCCGGCGATCCACGTATTGTACAGTTGGCGAATTCGCTAAGCAATTCGGCTGCCAACTCGAATCAGTCACTGGGGGCGCAGTTTAGCGCTATCAT
TCAGAGCGGGGCCATCCCTGGTGTGACGACGTCGACTGCTCCGTCCCTTGCCACTGGAGGAGGCCGAATGCAGCGTGCGGCGGAGCGACTTGCAGCACGG
CAACAAAATGGCGAAGACGTATCCATTGGTCGTCGCAATGTCGCCCAAAACAATGGAGCAGGAAATAATAATGGCCAAGGAACAGATAAACGCCAGCCCA
AGACCCCACCTGTGAGTTCCCGAGTGCAAGATGATACAGCAAATGACGAGCctgaagatggagaggtAGGTGCAGCTTCACCGGCTCAATCCACGTCATC
GCGACACAAGAGGAGATCATCGTCTGTGGGCGATGATGATCGGTCCTCGGTGAGAAAGAAACACCGGAACAGTAGCAGCGATAGCACTGGCAAGAAAGAC
AAACGGAAGAAAGAACAACGACGGAGTAACCCTAGTGGGCAAAATACGGAGCCCGATGCCCCTGCAGAGGTTCCAAGTGTGGCTGCATATGTGGCACcgt
tgccattgctctcgACAGATGATTGTTACGACAAGTGGAAGCCTAACAAGAAGCTACGCGAGATCCGCCAGGTGCTGAAAAAGATGAAGATTATGGCTGA
GTGGTCTCGCAACCAAAAGGATGAGACTGTTGTCGAAAAAGTATTCAAGTACGTGAGTACTATTGGAGAAGCCATCGATCGAATCGTGGCGCAACATGAG
GATAAGATTGGTGACAACCAGGCTTCGGCGAGCAACGGGACTTTATCATCTCGAGAAGCTGACGAGCTGTGTACATGTCTGTGGACATATGCAGCTGGTT
TCACGCCCTTCACAGCGCAGGGCTTTGAGCGTCTTTACGATGACATTTGTGCGGATGGTGACGCGTTAGTCGCTGCTGGTTCATGAGCCATTGTGGCTCA
TGAATGTGAAGCCTAGAGGTTGTGGGTCATTCAGGTCTTGATCGTGTACAGAGGACAATGGAAAATTAAACCCGGTATaaacaagaaaaacattATCCAG
ATCGAGACCAAGTTCGTACCAATGCAATCAATCAATGTTGTTTCTTAATAGTCGGCCAAGAAACGGTCGGACTGACGAGCTGTTTAGAGGAGACCGTTTA
TACTGTTGTGCTCTGAGGAACTTGTTGCACATGACGTCTTTGTTGCCCTCGTGTATacatccaccaccaacagcggaggagctggcgctCAAGGAACAAG
TAACACAAGTGTTAGCAAGTCAAGGTGTGCTGACCAAGTTAAAGGCCGAGTTGCGTGCAGCAGTCTTCCAGGTGATGCATGAGCGCGAAGGATTTATTGA
GAAAACAGACGCAAATGATGCTATAGCCCCGAAGTTGAGTGATTTTCCGGGAGAGACCGGAGCGACAGCCCTAGCGCTGATCGTTGAATGTCTAAAGTTC
TTCAAATGGGAACACACATTGGGGGTATTGCTTGTAGAAACCAACGCAGAAAGCGAGAAGCACGATGGTGCCGTGATGACAAAAAGGCTCGGACTTGACG
GCTCTATCTCCACTGGCAAGCCAACACTTTTCCAGCTCATTGAAACTAGGTTGCGTGGGGATAATGCTGCATCTGTTAGACCAGTGGTGGCTGCGCAATA
CGATCACTTCGACAGGGAtaatgatgatgaagaagagaaaccAACTGACGATATCCCAGCTATAAAGGCTATGCCACGGGAGCTGGAAGTAGTTGCCTGT
CCATCAGTTGCCACAGAGCTTGAAAAACGTGAGGAGACAAAAGTTGAGGAAGCTGAGAGCAGTGCGGAGATAGAAGAGAGCATGGCTGAAGAAGTGCCCA
GTGGATCAGATTTAGAGGAATCAAACTTTGCAGATGAAGGtcaggagaaggaagaggaagaagagagtcGATATCGAATCTCCAGTGTCAACGACAACAA
ATATCCAACTCCGCTGTACTCGACACAGCCACAAGGCCAATTCGCAAAAGATGATAAGGAAGAAGGCAGTGCTAGCGAGGATGGCCATGAGcatgaggat
gaggatgaggatgatctATCGTTAGCAGACCCACCGCCAGCACCCGCAGCGCTGCCAACTTTACCACCGCTCGTCAGTGCACCACATAGTACTCTTGCTA
CAGACGGAGAGGACGAGTTTGACACGGTAAGTACACTTTGCACGATTTGATTTGTCGTACAAACCGACTGACAGACGTGATCTTTGCGTATGAAAGGAAA
TGGAGGCCGAACGATTGAGAAATCTGGAGGCCGCGTTGCAAGCGATGGAGGCTGATGACGACACAGGCACACTACAACAACTGAAAGCATCATTGCAAAt
ggagctgcaagaacaagacaGTTTCGTGAGCAGTGTTGGGGCCGGCAGGGCGGAGGGCACCCACACAGAATTAGAAACGGGCAAGGCCGGCagggaggaa
gaagaagacgaggacggATATGGCTATGGAAGCGACttcgaagaggaagaagaaattgcCAGGTACAATTCTTAGACCGGTTTCACATTTTACTTACCTG
ATGCTGAAGTATCTGTGCACATGTTCCACTGACAGCGAAATCTCTGAGGAAATGGAGTCTATGGCGGACTTATCGGACAAAGAAGACGAGAGCGAGAACG
ATGTGGCAGTGCctacagcagaagcagagccACCTCGTGTACTTCAGAACGATACACGAGTAGACAGCGAAGATGCACTTAACAGCTATGATTACATTGA
AGACGTTGAGAATAAAGGGTGGTAAGGTGGTCTTGGCACGGTGTGCTACCCTTCACCCCCCGAAGAGCATAGCATCGAGGTCATAGTTCTAGTTAGATAA
ACCACGCGGTCAGTAAGCGCATACTTTGATCTTTTCACGGCATATATCCAGTCTACTAGCTCTATGGAAGCGTGACCCCGTGCTCTCTTCACTTGGCTGT
TTATTTTTTCCAACCAGgcatgaacttcttcagcaagGCAATATCCTTGAATTCCTCCGGGTGAATGAAGTATTGGCGGTCACGCGCCTGGAACGACACC
ATGGGGTGCTGTTTGGGGGGAGACACCTCCGACAGTAGGAACGAATGCTTCTGGGGCCGAGCAAAGAGCGACATTGTCTCCACGGTAACCATCGAATCGT
CTGTGACTGATGCCCCCGTGGCAGCAGATACTGGAGCCCCATCTTCAGCCTCAGAGTTTGCAATCCACATACGGATCACATACGGCTTGAACAGGTAGTG
GAAGAGCGACGTCGTTCCCAATCCGAAGAGCATCACAGTGCTGCACATGGCCCACTACAAAAGACATCAGTTCACAGAGTTCAATACTCCATATCGCTCC
CCTCACATCCCGTCTTTATAATTATATTGTTGCTCACCTTGCCGATCATGGAGGCGTCCTGCTCGCTCACTACACAGAGCACTGGCATGCCGATGGACGT
GAGGATGCAGCTGGTCACGGACACGCCCTTCATAATGCGAACGGCGCGTGCCATAGGTCCCTGATAAACAGGTTCACCTTCCACAGCGTCAACTTGTTGT
AAAATACGCTCCGTTTCCTCCTCATGCTTCTTCTGGACGTCGTCATCGGTTTGAGGAGCGCTAACATTGGAGCTCCATCGTCGACCGATAAAGTTTTCGG
TCGATGCGGCATTGCGGCGACTGTAGAAAGTCGATGGGAGTTGCTGCAACACCGACACGTGGACAGAACGCTTGACAATCTGAGGGGTCGAGCTGATGGA
TCGACACGAAGCAGAGAACGCCGTGGCGAGGCGCACAGCGCCACGAGGACCACGGTAGAGCAGCATTGATGTATGGGCACTTgtggccagcaagaagcat
GGTACCGGTTTGGATGGGTAGAACCGGTAGTTTACCGGCGTAATATTTGTAGCCAATCAACTCGCTATTACTGCATCatttttagccaatcaacTCACTC
TGGTAGCTGAATCGGTGCAGCGCATAGTGAGCCAAAACTGAACGAGTGTGTTGTTGAGCCATTCAGCCTGATGCGTCCACTCGGATAAGGTAGTCTAGAC
TGGACTCACTTGCAGCAGTCCAGTGAGCTGAGACGATATGTCGTCGTTGACTCAGTTGATTTTTAATCTTCCCCGTAGACGATACACTTTGCATCGCTGT
GAACAGACATAAGTGTCCATCGCATGCAACCAGGATTTGCAAATGGTGATTTGGTAAGCAACAAGCAATGGCCAGAGCATGTGGACCACACTGTGGTCCA
CAGAGCACCAGCGTCAGCAAAGTAGTTCGGCTTTGCCTAAGATTAAGCTGTACGATCTTTACCACAAGCATCGTCTTATTTCATCCCAAAGTGTTGGAGA
TTATGCTAGTCCGAGCCAACCGCTAATGAGGCCTGCTAAAAAAACCTTGTTGAAGTTTACCTGAACGAGTGCTGTTTTGCCGCCTTTCTATGGGTTTAAC
TGAAACGGCCTTTTTTTAGCATTCGGTGGCACAAGTCTCAACGTCGGCCATGTGGTGTTTACGATGAGTTGAGTGCACGTACGCAATGCAATCTTTACGA
TTGGTGCAACGCGCATAGCCGGATCGGGACGGACAGCTTGGATCGCTGCTTCCGAGCTACAAACCAATATCCTATCTCGTAGTACTCCCCCGAAAGAGTG
GCATGGTCCGAGGGAGGTCTGCTGATTTGGTTCTGTAGAGAGTGTTGGCGCCACCGAACGGCTAATCCCTAATTTGATTAGCCCGCTGAACTTcgatatt
ttttttttctttcgTGCCGCTAATGTATCAGCAATTGCCGGTGTACTCACTCCCGCACGCTAGTCTGTTACATCCATCCCAAGTCAATAGCATGCATATT
GTCCAGCCCCACTTCAGCGGCTTTACTGTGAAGCCGCCGAGGTTCACTCGAAGCCATAATATATTTCTGCCTCTTCTACTTTTCCCGTTGGCGCGGTTTC
TGTGGCCTTAAAATGGCGAGCGTTTCCCTCGTGTTTTTTATTCCGTAATTTATTCCCGTTTGAAAATCCACAGTCCACTTACAGTATGACTTTCGCGGCG
AAGAAAAACGGCCGACTGAGTGGCGAGAAGCCCACCCATTCGCCCCAGCTCACCGCCTTCCACCCATAGCAGCAGTCGCTCCCAGATCTCGTAGTGCGCG
CACGCGCGTCGTTGACTCCAACGCCCGGAAAGCTTTGGAGCTTTGGACTGCCGCAGGACAATGCAGCGTCGACAAATCGGTAACGCCAGCCCCACGGGCA
GTGGTAGTGGCCCTCGGCGCTCGTTGATGAACCCATTTGTAGCCCAGTCGACTCCGTATCAGTCTGGTaaccaacagcagcagccgtcAAATTATTTGCA
GTTCCAAGGGGCGACTATGCCCATAGGCAGCTtaagacaacaacaaccgcaGCAGTCTGGAGCTCACCACTTGCCAGGACGATATTGGCAGCCCCCGCCT
ACGATAGAGCCTTCAGCTTACGCGAGACAGGGGCAACACGGAGTCACCTTGGATTTGGAGTTCAACGATATGTTGGATACCAGTACCCCTGGAGCCAGCT
CAGTCAGAAGTGGAAGTGAGACGACTGAGTCTCAGGATATCAGCATGACCGGCTTCGACGTCAACTCGTTCCAAGACGGGGTGACAGGATCTTTAGGGCC
CCGGATGGCCGTACATACGGGTGATAATGCTGCCTCCACGCTACAAGCTCGGCCTCTAATGTCAGAGACAGCGTCCTCGCTCGCAGTGGATAATCAAGCA
GGAGCTGAGGTGACAGACACAGAAGAAACCATTAGGATGGTGGACGCGGCGTACTCGCGCTTCAGCAACCTCGAAGGCGAGCCGGACCTAACTCAGCACA
AAATcgaggagaagaacgagaggTGCGAGTATCACTCGTGTCCAAACCGTGCTCGCGTATCACAAGCGTACGGCAAATTTTGCAACCGGCACGTGATTGT
TGCACCATGTGGGTTCCCTGGATGTCGGGATAAGGCCGCTGAACAAGCCGTGATGTGTACAAAACACCTGAAGGAAGGCAAGGATGCACTGTACAAGATT
CTAGCCAACCGCCCCCAGAACGTGCCAGTGTGTCGTCAATTTGGTTGCTTCAAGAACGACCAAGGTCGTGGCTATTGCCGTGGACATGAGAAATTACTAA
TGGCCACCGGCCGCCTGCCTCCACACATCAACAAGCGTCGTCTCAACAGTGCATATACCATGTGCAGTTACCCCGACTGCAACAGACACTCGCAGCGGAA
CCACTTGTGTCGCACCCACGGAAATCTCGTCAAGAACCAAGCACAGGAACTGGCAGAACGACccgagaacgagaagaagttcGAGGAAATCCTGGACAGA
ATGCAGAAGGAAATTCGCCGCTGCACGCACGAAAATTGTACCAAAAACTCGCAACGAGATCGCCTTTGCACTCTGCACTACTACGAGAAACATAAGCTAC
AAAAAGGAAGCTCTGGTGCTGCATCTAAAGGATCCATGACTGAGGGAAAGATTCACGCGAACCAACTGGGCAATGACAGGAACGACGTTCGAGTTGTTGA
ACGTACGCGGTGCAGCACGCCGGGATGTGGTAACCTGTCGTATACAGCAGGACTGTGCGTGGAGCACGTGGAACAGAGCCAAAATCAACTGCACGACAGC
GATACTTTTTCGActggaggaaatgctggGGTTTCGACGGCCAACTTGAAAAGTGAGGCAAAACAGGGCTTCCATTTGACTGGGAAATCACAAGCAAGTG
GTACCCTACTTTCTTCTACTGCCACTGCCGGCACGAGATGCAACAACCCAATTTGTACCAGGGAAAGTTACGGTCGCAACTACTGCGATACGTGTCAAAA
TCTTTTCTTTGCACCTCTTGTAGTGTCCGTGGGAGATACGCCGCCTGGTGTATCAAGCTATCCCTCGATAGTAAGCAACGCCGTCCAAACTGGAGGAAGC
GATTTGCCTTGTCGCGTGAAATTTTGCGAGCTGGatgctgttcgtggtggtCTGTGTGATACGCATTTTCGAGCTTTCCAATCGGGTTCTTTGTCGGTGG
ATCAATTATCACTTGAttcacatcagcaacagcgcgAACAAGAGCTGGCCGATGCAGCTACAGtagctgctgtcgctgctgaggTTAAGCAAGTGAGTCC
CACAGCATCTGGAAAAATGAAGAAATACTTCTGCAAGGTCGATAAATGTGATAAGCAGGCCCAGAAGCGAGGTTTGTGCAAACGGCACTTTCGCCTGCAA
GAAGGTACCCTCACGGGGAAGTCACAATCGGCAGCTGGAGTAAGCGAAACAGGTAGCAACTTGTTGTCTCCTGTGGGGGAAAGCGATTTTTCTCCGACGC
CTACATCGTGCCGATTTCCAGGATGCTCCCAACTAGCATGTAGTGGTAGTCTGCTGTGTCTGACTCACTGCAAGGCGACGTTTTGCTGGCAACCTGGATG
TGACAACCTTGTGGACCACCCTCAATTCTGCGAATTCCACGCCTTCCGGCAACAATGCGCGTTTGAAAGCTGCATGTACAGTGCCGAGAGGAGTAGCAGC
GGCTGTGTGAGCCACATGAGGGCGAGGAGGTGTTGCCACGACTACTGTGACAAGTTCTCGGTGGGATCCGGCAGTGATTGGTGCCGGATACATCAGACGA
GCTGCCAGGAGTCTCCATGTGCGTTGTGCCGATTACATTCGTTGCCTCTGGGCGGGTTCGCGTCGGGTGAAGACGAGAACAGCAACCGGAGCCAGTTCAA
TGCCAACCTCATCCAAGCGAAGAGCCGCAGCAACCTGTTGGGCCACGAGTCGCGGCTGATGTAATTTCCGGTACCATCCACCAGAAGGGTGCAGCGATAG
TAGACACATCACTCGTTTCGAAGAGAGGAGTTTATATTAGGTCCAAGTGTCAAGGAGGTGTATTCTCGGCTATTAGGACGAGGAACAGCAAGTGTTAAAA
CTGTAGCGTAAAGAATCAAACTGAAATCGTGCTCTACTGTATTATAGTGCTGGgcactacatgtacttgtgCATGTATACTGTGTGCACCTACATGCAGT
GTAATCTTCATGTGTAATCTGCATGAAAATGGCGTATTAACGTGGCGCGTTACGTGGCGAGATGTCCTCGACTCTCCATCGAGATTTGCCTGGATAGCGT
TCATCACTTTTCCGCGGTACCGTACATTCCATACCAGTATGAAACCGGTATGGTTCAGTTTCCGTTGATGAAACCTGTGGCATCTTCCCCAAGCTTCAac
cgtcttcatcactgcagcCCCCCTCACTGTAATGGAGCGTATCTACTCGGCGTTCTTTACGACGGAGCGACGGCGAGAGCCGTCAGAGCTCACAGCCGCA
GCGTTGGAGCTTCATAACGAGTCGCAAAACCAGCAGAAAATCTCACGCCCTGTCGACGGAGATAAAAAACGACGACCagatgcagacgaagaaTCTCTAC
AAGAAGTCAAACGCCATGCAGCTGCCAGACGAGAGGAACTGCGCAAGTTGACGATGGATTGGCTGGCGGTCAGACACGACTTGGAAGCGGCGTGTCAGGC
GGCAGCGAGAGCGTTTCTACTGGCGTATGGAGCCAAAGCTTTCACTGCGGTACTGCTAGCGTCCAGGAAGTGGAGTAGTCTGGAGTATGGCTATGCGGAT
GCAGCAAGACTGCTGTTGAGGGGGGACACACTGCGCTTTGGCGCGTTTCTTGGCAGTTTGGTGGGCGTCTTTAGGGTTACTGAGCTCCTGGCTCGTGCTG
CACGTGGAGGACAACGTGATGCTGTGAATTTAGCCATTGCAGGGGCCGTTTCAGGctcggcgttgctgctggactcgCCGTCGAGACGGAGTACTATTTC
GCTGTACATTTTTGTACGgatgctggatgtggtgtGTCGTCATTTGATGTCGATTGGAGTGATCCCGACGTGGCGCTATTCGTCGGAGACGCTCTTTGCG
AtcagcaatgctgcaatTATGTATGCTTTTGTTGTGGACCCAAGTCTCTTGCCCAAGGTGCGTCGTGATGATAGTTATTGTGGCTTCAATAAGGCTAGTT
GTTTTGTTTTATAACGTTGTGGTGAGTTTGGGTCATGTCAGGGCTATTATCAATGGATCTGTCGTATTGGCGCTGTAAACCACTACGGCTTGGAATACAC
GATCCGTCAGCGAATGAGCGGTCAGCTAGATGCGCATGGACAGCCGCTGCCGTTCCGCTTGTGTCAGCCGCACTATCACATGTATGGCCGCGACTCTTGC
TGTGTTGTTCATCATGTGACGCTACGTACTATGCTCGCTTACATTCCCCTGTCGATGGAATAGGGAATCGTGCGTGACGCACGCTATCAAGGAATGGATT
AACGGTCTTGGCCGGTCGATGCAGATTTATCTGCCTGTGCACTTCCTCCCAGCCATGATCTTccgttttcagcagctgcagggAGCACTCGTATCCACTA
CTGCTCGGATCTCCTACTCAGCGCTCTGCTCTTCAGCGTTTCTCACGTCCTATCAGGTTCGTCAGCGGATTTACCAAATGAGTGTGGCGAATCATTAGGA
CTAAACTAACTGATGTCTGTACCATGACGTTTTACAGACGGTGGTGAAGCTAGTCGTTTGCACCGGTCGCAACGCTTTTCATCGAGATTTTGTCGCGACG
TCTCTGATGGCTGGGGTGAGTAAAATAATGCCTGTTTGCCAGCCAAAACGGAATGTTCACTAAAAATGCTGTGCTTTTGTCGACCAGATTGCAACGGGTG
GTTCTCTATTCTTTGAGCACACGAAGCGTCGGTTTGAGCTCATGCTGTATTGCTTCCCTCGCGCGTTAGATATCGTATGGCAGCTTTTGAAGCGCCGTGG
GCTTGTGCGCTATGTAAAGCACAGCGAGGTGGTGTTATTTTGCCTGTCCATGGCGCTCATCATGTCAAGCCCGGCGCGTCACTTCAAGCCAACATATCTC
CGGATCCTGCGGTTCATTTTTGGTGGGGACATAATCTGACCCAAGCTCCTTGCATACAGAAGTGAAAGCTGGCCTGGAGCATTTGTGGTTCACAAAAGCc
aagcagccaccaccaatCAATTGTTATTAACTCTACTTGCCATTTTAACCACTTTGATACTAGGACTTATTAGTACCCCACGTCGTTTAGGACAAACAAA
TCCAGCATTTGCTTGGCCTCCACGGGTTCAGACGCGGGCACAAGGTGACCGGCTCCCTTCACTGTCACGTATGTGAGACCTTTGAACTTCTCCACGAAGC
CGCCCGTTTGCTTCGAGTTGCCAGCCGCATAGATCCAAGGCGAGCGAGGTGCCAGGCGCGGAAGACGCAGAGATTCCACAGCCCAGAGTCCACCAAGGGG
ATTGCAGACCATGTCAGCATCACCGTGGTAAATCACGCCTTTAACTCCATTTTCAAGTAGCTCACGCCACAAAGGTGTAACCTCGGAGTTGAGCGTACCA
GAGTATTGAAGCAACTGAGCACGCTGGAGCTTCGGGTGATCCGCACCAAGTAGGGCGCTGAGTGGTTCCATGGTCGTTGTAGTTAGGGCGTCTCCACTCC
AGTGTGCCAGCGCAGGGTGCGCGTGCATTGAATCACGCACTTCAGCCAAATTAAAGAACGTTTCAAGGTGCTTCGTTTCCAGACACAGGTCCATCGTGTT
GCCAAGAGGGTGGGGGATTTTGCCAGCAACTGATGGTGCTGTGATTTCTTTAATGAGGCGTTGAATATCCTCCTTTGCCGACCCAGTACATGAGCTGTAG
ACATCATACATATTGATGCGGTCATAGATCACAGTCGTAAAAACCTCCACCATGGCATCCATGCACTCTGGACTGGCGTCGCCTACACCAGGCGCCATAA
AGGGGCTCTTCCCAAACTCGTGGAGATCAGGACAGCTAACACGAAACTTGTTGTACAGCTCGGTACTCAGAAGGCCGTGGTAGTACGCGAACATGACGGT
CGAGAGCCCCATGTATTCGTTCACGCCGTTCCCCACTACGAACTTCTTGAGATTAATACGTTTTTCTGGATCAGTGGAGCGTGCATTGCCTTTCACGATC
GCCAGGGCCGTAGTAGGCACATAAATCCCTCCGTAGCTCTCTCCTGAGATCACAAAGCTATTCGTTTTGAGCCATGGGAACTTGCCAAAGAACTTCTGCA
GCGCGTCGTACAGATCTTCTGCTTGTGACAAATCATCAGCTTCATACACACCACTGGCATTATAACTGAACCCCACGCCTACTGGGGACTCAATGCACAA
TAGATTAGCTCGTTGGTTCCACGCGAACTTGTTGGTACGTAGAGATCGTCCCTCTTCGTTGACTAACAGCGGGCCGTTCTCTGAGAAGCAGCCAGCTAAT
GAGCTGGACCCAGGACCTCCATTaagccacagcagcactggGTCGATCTCCGGCGTAGAACTCTGAGATTCAGCCAAGAAATAGAAGGCTTGGCCCCCAT
TTTCTAGCGACAGGTAGCCTGAGAAGAGTCTCGCCGTGTAGTCGCTTGGTTTGCCTGGGAGGTCTGTAATCTCGTCCACAGAGCCTGAGAAACCTTGGGG
AGGAAACTCTGGCTGCTCGTTGTCTGCTGAGTCCTCCATCACCGTGGCTTGAGGCTTGTGATCCGCCGTCCGGATGAGGTTCTCCGTCTGGAGTGAGTGC
TGGAGCGTCACCATGAGGTCCCCCACcgccaggaagagcaggcaCATGAGCGCGTATTTGATGAAGCGACGGCCTGTGGCAGATAGAAAACGGCGAGAGG
GGCCAGTGGACTGGGATGTCTGGCGAGAAGGAAGGCCACGTGTCAGCGGCAACCTCTCATTGCGCGCGTACATCGTGAATCAGGGACGGCAAAAGGAGTT
GTGAGCCAGGAATAGTAAACATAAAAGAAGAATGATGGTAGAAGTTCGGAGTCAAAGGAGTCTTACAAATAGTGAAATGAACAATTTTAAAGTTTATTTG
ACTGGATACAACTTCAAGGTCGAAAATAAATTTCTGAAGTTTGAACTGGGCAGCATTTGATTGATTTGTAATGATTTGATACCTACACGACTAGTGCATA
CCTCCTTCGAGCACAACCGTTCGACGATCCAAGCTCTGGTTGGACGTACACGCGCAACGTACGAAAAAAAAGGAAGGCGAAAACCATAAaacaccaccag
cttcacTCTTCCGACAGTTTATCCAGGAGGCAGCATCGTGCTGTCCATGTCGTCACCATCAGCCTCGTCCAGGATCGAACGTGTAGCACCCTCGAAGGTG
ATATCGCCGAGGTTGTCAgcgacgttggtgctgcgtgcCATGGCGATGACACCACTACGGTGGATCTCCGTGATGCCCAGAGGCTTCAGCAGGTCCAGGA
AGGCCTCGATACGACCGGGTGTGCCAGCCAGCTGCACCATAACCTGGTGCGGTCGCACGTCGATCACCTTTGCGTCGAACAGGTTGGCCAGCTCAACGAC
CTCAGCGCGAGACCCAGCTTCTGCTCAATTATGGAGAAAAAATAGTCAGTACTACAGAGCAAGTTGTATAGTGCAAATTTTTTGCACGTACCAGCCGTGG
AGACCTTGGCCAGCATCAGATCCCTCTCAACGTAGTTCTTCTGGGCTTCCTTGCCACTGCTCAAGATGTTCACAACAGCCACGTACACAacgtcctccag
ctgcttcttcatctgtgTATACACAAATCAACGTATGTCAGCAATCGTGCTCTTGGTTGTCCTAGAAAACACAAATTTGATCCGTACGTTCACAACACTC
TGGGCAGTGCCGTTCACAACAACAGTCATACGGGACAGTTCCTCGACCTCCGTGCGGCCCACCACTAGACTGTCAATGTTGTATCCTGCACCAGTCACAA
CAATTTATTTAGCCATGCTTCCGAAGAGTCTCTAACCCATCCATTTTCTAAACGTTTAAGATCAAACAATCTAAAATCCAACCTCGAGACGCGAAGAGGT
TGGAGATCTCAGCCAGACAGCCAGGCTGGTTAACCACCAGTGCAGCGATCACATGGCGTTGGCTCTGCGAACTGAAGGCACGAGAGAAACACTTGGGCGC
GACCGGAGCGGGCGTCACAGCGGCTATCGACCGTGGGAAGGCGCGACGCGCCAGGGGCAGCACGGACCTCCGCAACATCGTTAGGTTCCACGGCAAATGC
GAATGTGTCGTCCAAGAGGCTCAAACGGCATTTGCGCAAGCAGACCACCGGTTTTATTCAACAGCTgtttttcaaccaatcaaatcagCTAAAATATaca
tttcaaccaatcaaataaCCCCATTTCTTTGGTTGCGCAAACATCCCATTCTCAGTCAAAGCGAAAGATGTGGAAAATGCTCGTGGCCTGCGTCTGGACA
GTGCTGGTGTGGGCGTGTTATGGTCTTCCAGAGTCTCTTACTGCTGCTACCGGTATTGCTCATGAACACGTCTACGACCCCCTAACATCGGTATTTGCCG
AGCTGCGAACTCCCTCTGTGGCGCCTAATGACGCTGATCTGGGTAATCTGCTGGCCAATATGACGGTGCGGCAAAAGGTGGCGCAGATGACGCAGATGGA
CATTTATTCCATGATGGATGGCGACCAACGAGATCCAAACAAAGCATTAAAGAGAGATGTCGTGGCGGAATACGCTCGAGCAGGTGTGGGCTCCATACTC
AACAGTCCGTTTGCAGGGGGTCCAGTTGGTGGACGAACTGGATGGAGCGCTAGTGACTGGCGGATAGTAATAGCTAAGATCCACCAGATTTATAAGGAAG
AAGGGGCTGCTGTGCCTATGCTTTATGGAGTGGACACAATCCACGGAGCTACGTATGTGCAGGGCGCCACTCTATTCGGACAACCGATCAGTGCGGCAGC
CTCGTTCAACCCTGACCTGGTGTACAAGATGGGGGTTGTAGCTGCTAAAGACACTTTGAGTGCTGGGATTCCGTGGATTTTCAGTCCTGTGTTGGGTATT
GCAGTGCAACCAAAATGGGCTCGTGTGTATGAGACGTTCGGAGAAGATCCGTTGCTGGCGTCGGTCATGGGTGCGGCGTTGGTGCGAGGCCTGCAGAGTT
CGGGCAAAGTAGCGGCTTGTATGAAACACTTCATCGGATACTCGAATGTCCGTGAAGGGCTGGATCGGGCTGATAATGTCATTACGGACTGGGAACTTGT
TAATTACTACGCACCATCATTccttgctgcagttcgtgcTGGGGTGCGTACCGCGATGGAGAGCTACGTGTCTGTGAATGGCGTCCCGGTGATTGCTAGC
AAAAAGTTGCTCGTGGACTTGCTGCGGCATGACATGAACTTCACAGGTCTGCTGGTCTCCGACTACAGCGAGGTGGACCGTATGGTTTGGGAGCATCACT
TAGTTCCCAGTGTAGCAGATGCCGTCCGCGTGACATTGCAAGAAACGTCTCTCGATATGAACATGTCGCCAAATTTAAAGGCTTTCAGCGACACGATCGA
GTCACTCGTCGCTAAAGGGCTTATTCCCGAGAGCCGTCTGGATGAATCCGTGCGACGCATCTTGGAAGTCAAACGTGACTTAGGGCTTCTTGACCTCAGC
TATTACGATGAGTTTAGCCaagacagcatcgacagTGATAGTGAAGTCGGTAGTGCCATTGACCAGGGAGACGCATTGTCACTGGCCCAGGAATCTGTTA
TTTTGCTGGAGAACTATAAGAACACTCTTCCTATCGACGCGCAGAAAGCGAAGAGTGTGTTTGTCACGGGGCCTGTGTCAGACAACAAAGGTTATCTGTG
TGGAGGGTGGTCTGTATTTTGGCAGGGGTCTACTACCTCGTCAGTCTTCCCCAACGGCCTCACATTCAAAGAAGCTGTGCAGGCCAAGGCAGAGTCTTCA
GGTGGACAAATGGATGTCGAGCACTTGGAAGTGGTTGATATCGACGGCAACATAAATCCCCAAGACTTTCAGCGGGGATTAGAACTCGCAGCTAAGAGCG
AATACACTCTAGTGGCACTGGGCGAGAAAAACTATGCGGAGAAGACTGGCGACTTACTTGGCAGCTTGGCTCTCCCCTCCGGCCAGTTATGGTATATTGA
AGAACTCGCGAAGTTGAATTCTACCAAAGTAATTGTCGTCCTCGTTTCAGGTCGCCCCCGGTTGTTAGAGGGAGCCCACAACCACGCAGACGCTGTTCTG
TTGAGTATGCTTCCTTGTGAGCAAGGCGGTCAAGCGATATCCGACGTAATATTTGGTGATGTGAATCCATCAGCTCGATTGCCGATTACGTATCCGGTAC
GTGAAACTCAGCTACTGCCGTATTTCCATCGTGTGAACACACGGTGCCAACCGTTTGACGAGTGCCCCGTGCAGTGGGAATTTGGCCATGGACTGAGCTA
CTCGAAATTCGAATACTCGTCGATGCAGCTCAACACTACTCACGTGCATGCCAAGACTGGCGCTCTGCTGGTGAGCGTGACTGTGACAAACCGCGGTACC
CGTCCAGGAAAAGAGGTTGTAATGCTGTTCGTGGCTCAGAAGTATCGTCGAGCAGCCGTGCCTGAAAACAAATTGCTGAGAGCAttcaagaagctggatg
aATTGGCACCAGGTGCTAGCCAGGACGTTGAGTTCGTGCTTACGCCCGATGACTGGAGCTACTATTTGCCGGGTCTTGTAGGTCGCGGGTTTCAGAAACA
AGCCGAGCCTGGTGAGTTTGCTATCTCGTTGCTCCCATCTGCAACAGATAGCTCGGCCATGGCAAACCCGAGTCTGTGGGGCAATGATAAAAAGGCGAGA
GACGGTCAAGGCAAGAATCGCGGCGGTCCCAACACCGGTGGCAGCACAGTGAAACACGTGAACAACTCCAAAGAGTCGCAGCGGGAATGGACGACTGCAT
CACCTTCCCCGGTGAGCATACCATTTTTTGTGGTACCCTAGTGATCCGGTAGTTGAGCAGTGTGA