Description :
From Genome Similarity Track
Location :
Scaffold_85:36005- 37238
Sequence
1233 bases(100 bases per row)
CTATCGATGTAGCGGTGCGTTGGGTTGAGCAGTGACCAGTATTACCAGGACCGAATTAAAGAGTTGGAGGACCAGTTGCATCGAAAGGCACAAGTCGAGG
AAGAGCATCGTGCCTTATTCCCAGAGCGAGACAGCTCCAGGGCCTCATCGAAATTGTCTGTACGGTCTTCTTGCTACGTCTCCAGTTTCGCAACCGAAGA
ATCCAAGCAAGATACCAAGCTTCGACGGACTCGAACAGTTTTGAAAAAGGTATGTTGCGTCATATTTACCAGGGTAAAGCACCAAATTGCTGACTGTGGC
GTCCACTCCACGACAGAAGGCAACCAAAAGAAACTCGAAGACTGCTCAATCAGGCGACCGAGAGGCACGCGATCGCCGCGGCAGAGTGAAATAGCGCCAC
AACGAGAGCGCAATAGATAGATAGACCAGACCGACTGTTCTCAAGACATGAGCGCTTTCCCCTCTGCGATGGTTTGAAGCAAATAATCTGCCGCTGGTAC
TCCCACGACAATTTTGTACTCCTACAGCAGCTCGGTGCGAGCGTTAGACCGCTAGCCCCCGCCAATTTTTTGCAGGCACGCACCTCCAAAATGCGCATGA
TCCGGTCTGCAGCTTCGTATCGAGCCTTGATGATCAGGGCCATTTGACGCCTAGACTGCCGTGATCCTGGTCCGTTGGGGCCGCTAAATTCCAGGAGCTC
TGCACCAATGAGTAAGTGAGCGTTAAACTTCGAGATAACAGGCGAAGCAGTTCAAAGCGTACCAACCGATTTCTCTGCGCGTCTCCTTGGCGATTTCATC
CTGGAGGACGTGCAGCAGGTGCTCAATCTTTCTGCGATGACGGTCGATGCGAGCTGTTTCTGCGGCCGCAGTGGCCTCCTCAATGTTTTGATGACTGCGA
AGAAGAGTTTGACGAGGTTTCTTCCTCCGATCAAAGTTGTAGAACTGCCTGTCGACCACTGCGCAGTGGCGCTCTCTCGCCAGGGCAGTCTGCTAGCAGG
TATTAGGCGAAGTGTTGGTGAAACATGCTGCACAAACAACTACTAACGCACCGCTGCTAGTGCCGCTTCTCGATCCGCATCCATCTCCCGCTCACGGACG
AAGAACTCGCGGTCCTCGGCTGCCACACCCGGGGAATAGTATCGTGGGCCGAGGTGCCCCACAAAGTGGACCGTGGTGTCAGCCGGCGGGTCCATCGCAC
GCATGCTTTTCATGAACTTGTTCATGTCGCCCC