Description :
From Genome Similarity Track
Location :
Scaffold_1967:3600- 5298
Sequence
1698 bases(100 bases per row)
GGTTGAAGGTATGTAGAATCTACTCGATTCAGCCCGGTGGAAGCTAGCTTGTTGTGTCATCCATTACACTGTGTGCACGGGGGGAGGACGCAACTAAACT
CGGGACTCGCGAATTACTTGGCGAACAGAATCCTctgactgcagcagcgcattaCGGCCATCTTGACGTGATGAAATGGTGCGTAGGTAAAGGGATTCAC
GTGGACGAgaaagacgacgaaggcTTTACAGCTTTGGTGCTAGCCGCAAGTCAAAGGCACTTCGCTACTGTGCAGTGGCTGGTTGAACAGGGCGCTCAAG
TGGAGAGTCAAAATGGAAATGGCAATACAGCGCTACTTTGCGCTGCAGGCATCGGTCACTTGGAGATGGTGAAGTATTTGGTGAGAAAACGTACTCAAGT
GAATGAAAAGGATGACCATGGGAAGACCCCGCTGCACTTTGCAGCCGACGCTTCCGAGGAAAACGTCGTTGTTGTGCAGTATCTCTTGGGCAAGGGACTG
GAGTTCTGCCATTGACAAGTGGGGGCGAACTGCTCTGCACTACGCTAGCACAGCCCATAACTTTGACGTTGCCGAGTTCTTGCTGAAAGAGTGCTTTCGG
GACAGCAAACCGCCAATTGCAGACTTGTAGCGTACGCTCTTCGAGGCAGCCAAGGGAGACCGTCTGGggctccaccagctcttgGTCGAATACGGCGTGG
ATGTCCACCACAAAACGTTTCGAGGAAGAACTGCACTGCACGAGGCAGGGGCTAACGGCGCTGTCAAGTCGGTTGAGTTCTTGCTAAGTCACGGCGTCAC
TCTAGCTGAAGCAGACAAATTCGGTGCGACGCCTGTACTTGAGGTAAGCCGGCACGGCCACACGAGCGCTTTATCGATTCTACTGGAAGCAGGTGGCAGC
ATTGCGGATCTGAATTTTGCCGGCCGGACCGCGCTACATCTTGCAGCACAAGGTGGGGCATGACGAAGTTGTAGATCTGATGGTGAAGCGAGGCGCTGAT
ATCCACACAAGTGATAAACGCGGGTGGACTCCATTGCATAGCGCCGCTGCGGCCGGTCATGCTCACGCTGTGAGGAGATTGGTAGATCATGGGGCTCTGT
TGCATTCCAAGACAATTTCCGGATTTTCGGCGGAGGTTTTGGCACTGCAACAGGGCCATTCGGATGTGGCCAGCTCTTTGAACAGCGACTCTGAAGTTCC
AGATGCACTGACAAGTGCTGNGCCCTACTTCGTCTACGAACGCCCAACCTACGACTCAATGTTTGATTATCTTTACGATGGCGAACCAGTGACGACGATC
CAGGATGTCTGGGGCAGGATGTACGAGGCGGCTCTGGGATTGCAATATTTACACGACCGCAACATCGTTCACGGACACGTTTGCAGCTACAGCATCGCCG
TGGCTTCTAACGGAGTGGCAAAGCTCCACGTGTTCGATGGTGTGCAGAATGAGCTTACGTCGACTCCAGAAACGGTATCTGGGTTGCCGCCCTCCTTTGA
TTCCGACGTCTTCGCTTTTGGGTTTGTCATCGTCTAATCCATCACCCGAAGTTCTCTGCGCTACCAAGTCGACTGGGATGATTTTGACGACGCTATGTTG
TCTGGGGAGCTTCCTAAGAAACCTGAATGCATGACGACCAGTCAATGGCGTCTTATCGAGGGAATGTGCCGCTACGACCCGAGCACCCGTCTGTCCAT