Description :
From Genome Similarity Track
Location :
Scaffold_3767:360- 2684
Sequence
2324 bases(100 bases per row)
TTTATAAAATAAACAGGTTCATTGAGCTGCTTTATTATGGTAGAAAATACACTGTGGAAGTCTGTAAAGGAGGATAGTGTCAAATATGTATTTGAAAGAG
GTTTCCTAGAATAAAGTTGCACTTTTGCTGCCTCATTATAGTGACCTTGTGTCAATTAGTGATTTATGGAAAACCCACCTTTCATATCAATATTTAGCAT
TCACATACAAAGTCCAAGTCAATATTTGTATAAATATTGATTAAACTGGTGAGCTTCTTACATCCTTGCCACTCAATCGAGGGTGCTGCTCCAAATACCG
CTGGGTTTGACAGGCTGGCTGCAAAAGGGAAAGCGTGCTCACATAAAACACAAAGGTGGCCATATTGGACAGCTACGCTCGTGTCGCTCGCTTGGTGACG
CCGTGTATTTATATCAGAAGGCCAGCTCCGCATATACCACGTGAGCGAGCGATGGCGCACCACCATGCGCTGCTGGACGACGACGAGCTCCACATGACGC
TGGACGACGACATGTGCGCGCTCGAAGCGCTAGACGACACGGACGTGGATATGGACGGCCTGGGCCAGCAACACCAGAACGAACAGGACGGCGACGTGTT
CCGGCCGAGCGCCATGCTGGACCGGCGCATGGAGGAGGAGTTCGGCGGCGCGTTCTACTCGACGTGCTTCCAGGCGTCCGAGCTGGTCGAAAAGGACCTC
GCCGGCGGCTTCGTGGACATTGAGCAGATGCTGCTAAGCGAGTCGGAGGAGTTCCTCACGGCGCACTTCGCGAACACGAGCGACGAGCTTCTGCACGCGC
AGCTGCGGAATGGCGAACGCGAGCAGATGAACCAGCAGCAGCGCATGATCCGGGCCGAGCTCACGGCGCGCCACTTTCTCCACGCGCAGAGCAGTGGCGA
CAACATTACGGACCAGCAGCAGCGCCTCGTGCTGCTCAAGCAAGCAATCGCGTCCTCGGCGCTGTCGTCGTCGTCGATCTTCAACATGCCGCCCAAGTAC
TTTGCAGGTGGCGGCTCGAGCTCTCCGCAGAAGCGCCGCGCGCATCGTCGCACGTTTGGCGAGCGTACGCAGCCCTTCGCGTTCGGCACCAGCAACGCGA
CTGCTTATAAACAGGAAGACCAGGCAGCGACAGGTGGCAACAGCTACCACCAGCAGCACACCAGCGGTATGCATGATGCGACTGCGAGCGACGAGAACTA
CCAACCACCAATTTCAAGCGCAACGCCATCCAACGAAGTGTACATCAAGGAGGAGATCGTCATCGACACTGGCGTGGCGCAATTACACACTGTCGCACTT
GAAATAACCGCGTCGAAGGCCATGGACGACGGTCACGACGACGAGCAGAAGGCTGCGACTGTGCTGGACTCCCGATCACAGACGCCAGTGACTCTCCTGC
CCTTCGCTGGCTTCCGGAGTATCAGCGACGACCACCACCACGAGATCAACGGCGTCCACGAAGAAGAAGCTTTGCGAGCGACGTTCCGAACGCCGCTGCG
CCGAAGTCTCTCGTCCCCATCGCCATCCCAGGCCGCAGAGCAGCACTTCACGCCCCAGCAGCAGCAGCAGCTCTCCGGCTACTCGAGTCGCTCCATGTCG
CCCGCCGACGCGTTCGACAAGGTCGCTGTCGTGGTGCAGGTCGTCAAAGACTCCCCGGGACGGGTCGACAAATTCGAGTGGCGCATCGGCTCGCCGCAGC
AACAGCAGCAGCAAAATGACGCGAAGCAGGTGAAGAAGCGACCAACCCTGTCGACGCAGCTGGGGAAGGCGGACGCGAGCCACGTCGACGACCAGGCATC
ATTCAAAGCCGCTGCTGAAACTCACGACGCGACAAATGAGAGCTCGTCAGCGCTGCCGCCGCGGTACTTTCGCGGCGTCACGAGTTCGCCGCAGAAGCGG
CGCGTGCACTCGACGACGTTCGGCTCCTTCGCGCGCTCCTTCTCGTTCACAGGCTCGGCGCCGCCCAGCGACCTGTAAAGAAGAGCTCTGCGTGGTGCAC
ACATTTGTTTTTCTCTCTCACTCTCTTCAGTTTAGTTATATAATAAGTTTTTGACTCAGGCGACGTCTCTTGGCTCACTTCAGCATGCAAGATGGCGACG
AGAGCGACTCGCTGGCGAGCAGGCCTGCGATCCTGGGATCCGCCGAGGTCTTCCTGCGGCCACTGCGGTTCATGTGCGTCTCTGTAGGTGGCTGCTAGCG
AAGGAGCTGCTTGGGAAATCCTAATACTACTGCTGTGTTCTGCAGGTTTGACGTGGAGACGGACATCGCGGTAGTCACTCGTCACAGCATTAGCACCGCT
CCGAGCCCCAGAGCTGAGACTGAG