Description :
From Genome Similarity Track
Location :
Scaffold_3353:360- 1622
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3353-snap-gene-0.0Amino Acid/Auxin Permease (AAAP) Family

Sequence
1262 bases(100 bases per row)
AAAGCTTGTCACGCTTGAAGACGCAAAAATTGCGTTTAACATCTTTTGTTGTGTCTACGGCATCGGTACCCTCGGCATGCCAGCTAACTTCTCCCGAGCT
GGACCAGTGATCGCCACGTTCGCGTTGGTCTTTATGGCGTTTGCCAACATCTACTCCGGTGTAGCCTGCTCCAAGGTCATGCTTGCGGCCCCGAACAGAG
TCAAGACGTTTGGTGATCTCGGTGAATGGTGCATGGGCAAGACTGGACGGTACCTCGTCGTCACTTCGCAGATGGGTGTTTGTCTGTTGGTGCCGTGCGC
GTTTTTGGTACTGGGCGGAACTCTGTTGCAGAGTCTCTTCCCGGATACTTTTGAGTCGTCAACTTGGATTATCCTCATGGCGGTCGCCGTTATGCCAGTT
TGCTTGACTCCAACTCTCAAGGAAGGAGCTGGAGCTGCATTTGCTGGCTGCATGGGTACGCTTATCGCGGATGTCATCGGTGTTGCTGTCTTGCTGCACG
ACATGAGCGGTCATCCATCGGTACCAACGCCTGATATCTCGTTCAAGCAAGTTGCGACGACGTTCGGCAATTTGTCGCTTGCTTATGGTGCTACGATTGT
AATTCCTGCTCTGCAACGCCAGCACAGTGACCCGACGCGCATGCCTCGCNNNNNNNNNNGCTGACCTTCATCTCCGTGCTGTTCTTGGCGCTCGCTGGCT
CGGGTTACTCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTCACTATTTTCCCAGATCCAGTTACTGGATTA
AGCAAACTGGGTTTTGCATCGAACAAGGGCATGGTCGTACTGGCGTACTTGTGCATGCAGTTGCACATCACGATCGCTTTCGCCGTCATTGTCTCGCCAG
TATTCTACATTGCTGAGCGGCTGGTGTTGGGAATGCACCCAAAGAAAGAAGATGACATGGAAGCTCTCAACTACGAATCTGCCGACACCCCTTCTATTGA
TTTGAAGCCTCGCACCTCGAAGAACTCGGTGGTCTCTATCGCTGACATTGAAAAAGAAAGTTTGGACGAAGACACAGAAGCCGCTGAATACACGGGTGCC
TTCGCATGGAAGTACGCCTTGCTCCGCACTTGCATCGTTTGCATTCAGGTGATATCATCGGTCCTCTTGAGAGATCACTTCTTGGACCTCAACGACTTCA
TCGGCGCGTCGTGCATGACAATGAGTTGTATCATCTTGCCAATCGTGTTCTACTTGAAGAAG