Description :
From Genome Similarity Track
Location :
Scaffold_2096:36- 3172
Sequence
3136 bases(100 bases per row)
TGCAGGGCCCGGGCTCCTCCCGACAAGGCCCGTGGAAGAGTGTATCACATCTTCGATGACGAGACAGGTTTACCCGTCAAGGCATCTGTGTCCACTTGGA
ACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTC
ATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAGCGTCAGGCGCGCTTGGGTT
CTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCAACGGATCG
AGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAGCAGTGCGAGGTCATTGATGCCTTC
TTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGTAAAGTGGCGTCTGG
TTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTA
CAGTGCGCTGGATTTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGA
GTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTAC
TTCGACGACATAATTCGTCTCTTACCCTGCCGCGGGGAGGAGAGAAAAAACCCCCCTGTGAGGTGGCTTTCTAGAAACACCTCCGCCGAGAGGTGGGACC
TAATGCGAGGGAAACAGCTCTACGCCAACATCGAACAGTGCGTTTTCGCGTCACCAGATATTATAGTTTCTCGGTTGCTTCGTCAGCAACGTTGGGCGTT
CGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGATCTTCGAAAGTGGGTTGGGCTTGGCCAACTATCTTCACA
AGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGAATGGTCGCTGGGAACAAGAGCACCAGGATGCTTTTG
ACAGCATCAAGGCTAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGG
GTTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGA
CAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGG
ACGGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCA
ACGTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCG
GGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGA
TATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTAGAGCCCACTGATCCTCCACGGGTGGTTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCG
CGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGT
CGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGG
AAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATC
TTGCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGA
CCGAGACCCGCGGTTTACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGAC
CAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTG
CGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGA
CTCCTCTATTCTAAGTGGGGGAGATGCTCGGAAAGCCCGTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGAAAACAGGTGGAATCCTTTATG
GATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAA
GTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAACTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCAT
CGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACATCATCGACCTTCCAAAGTCAATGAAGACGCACCCGACGTTCTATGTCGGACGTCTTAAG
CGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAG