Description :
From Genome Similarity Track
Location :
Scaffold_2574:36- 2890
Sequence
2854 bases(100 bases per row)
GGGTCCAAGTTACGCTTTAGACGTTCGACATAGAACGTGGGGTGCCGTCGTTCATTGACTTTGGGAAGTCGATGGTGTCCGGCCGCCCCATGTCTGGGCC
AGGACTGCAAAAAGTTCCGATGGAAGCGGGTCTTTCAGCCTTGTTGCTGTCCGACAGAGCTGACAGTGTCTAAGCCGGTAGGTTCCTCGTGTCTAGTAAC
ACTAAGTCCCCCACTTTTAAATACACTTAAGTTTCCTCTCCCATGTTTGTCCGAGTACTCCTTTTGTTTATCTTGGGCGCTGGCATGGCATCGCGGGACC
CTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAG
CCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAACCCGTTCAAGTAGAACGGCGTGAGCCCCG
TGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTC
GAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAA
AACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGC
CCGTCACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGGTGCCGTGTCCGTCGGCGGGAAGCCC
AAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTAACCCGCTGACAT
GTTTCACATGTCTTGAGTACCGGGCGACCCACTGTACATGTGGGTCCACCAGAAGATGAGAGACGACGAAGGTCTTCTCGCGGCCCAATGGCGCGGAGGC
GCTCTGGCTCGGAGATGTGAATTCAATCTCTCTGGGTAGACCACCCGGGGAGATGCAGGGGGTCTCCCACGCGATATTGAGAGGAGGCCTCCTTCAATAT
CATATGCGGTGGGAAGCGTGAGGCGCTGTGGGGAGGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGGACGATAGGCGCGACAGCCT
CATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCTAGAGAGGGCGTCCGC
AAGCACGTTGAGCTTGCCCGGCTTGTACTCGACGCGGAAGTTATATTCCGCGAAGAAGGACAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAGTTA
GTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCGTAGAGCCCAGAAGGTGAACACGGAACTTCACAATGGCATATTTCATTGCCAGGA
GCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAA
TGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTG
ATGCTGTCAAAATCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGC
TGTACTTGTGAAGGTAGTTGGCCAAACACAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTGTCTGGGTCA
GCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTGATCTCTGGTGACGCGAAAACGCACTGGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCA
TCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCTTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTG
TACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGC
ATGCCTCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGC
TCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCA
CTTTCCGTTCGGCTTAAGAGACGCAGAAAGTCGGCGTCGAGTGCGGGGATTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCA
ATGATCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTCCGCCTCGATCCGATG
GGAGTTGGGTCGGTGGGTGTTTGTTCACCACGTCCGCATACTCCGACACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATCTCTGAACCCAAGCG
CGCCAGACGCTGCTGGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGA