Description :
From Genome Similarity Track
Location :
Scaffold_3844:36- 2791
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3844-snap-gene-0.0Phosphatidylinositol kinase (PIK-L4)

Sequence
2755 bases(100 bases per row)
GCGTTTCGCGCGCTTCTCGCTCACCGTGTCGTGCGCCGTGGAGACAAATAAACCCTTGTTCAGCTTCGTGCAAAAAGTGTAGTTTGTGCAGCAGCGGGTA
GGCGCGCTGGTAAGACTCTGCGCATGCCGCTGCCAGCGGACCCATGATCTCCAATCGGGCTTCTCGTAAGCTCTTGAGAACGGCAGCCGGTTTGTCTTCG
TGAAAGCTATGCAATACACGGACAAGGGAAAGCTGGGATACGTCGAGGTTCCGCAAGCGCGAGGACATGCCGCCTTGAGCTAAGCTATTGGAGAGCGATG
ACGTCTGTTGTTCCGTGTTGAGCAATTCCGAAACAAGTTCCCATCGGGAGAGGCGCCAAGCGCACTCGAGCGCATGAGGGTATAGCGTGCCCACAAACTG
TGGCTCCTGTGTGACAATACCGTTGATGTGCTGGAGAGCGCTCTCAAGTCGACCGAGCTGGATCAAACATTGGACAATGCCGGAGTATAGTGCCGGCTTG
ACCGATCGTGAGTCTCGGATCTTGTTCAAATCAATGAACGGGCCTTGTTGCGCATCCTCCTCGTCATCCATGATATCCCCGGAGAAAAAGCCATGGTTTG
CTTCAGCCGAACGAATCTCCTGGATGGCTAGCTCGTAGCACGCAAGAGCATCCTCCCATTGGGCAAGCTGTTCATGGTCGACGACCTGATGAAGGAGATC
GGCCAAAGTTGAGTTGGATTCCTCCACTTCCGCCGTACCTCGTTCCGTCGCAGGAAGCTGCGCATCGTACAGACGTCGTAGAGTAGCCAATCCGGTGAGA
GCATCAGGCTCATCGACGCGACTATATAACTGTTGAAGATACGTCGCATGCTTTGATACGAGCGTCAAATCAACAGGTAGCGTAGCGAGTAGCGTGCTTG
TGGTGGTTTTGGACTCTTTCTTCTTCGGCGGCTGTTGTTGGCGTAGGTAGACTTCAAAGTATTGAAGGGCTCGTGCATAGGCCTTGATGTTGAACGCTGC
ACTAGATAGAACTTGGCTCGGAGTATCCTTCAAAAACTCTTCGAGATATTCCTTTTCTTGGTCATCCATATCCGACGGAGCGGACGTAGACGCCGACGAC
CGGCTTGTCGAAGCACTCAGTGCTAAGCGCTTTTTCTCGTTACTCCACACCCACTCGTTGAGCTCATCAATTGTGGATACAATCGTTTGCACGCATTGAT
GATGGCGACTCGCATACTCTCCAAACGCTCGCTCGTTTGAGTCATCCGGTCGGCTAGTGGAAGAGTGACTCTGCCCAATACACGCACTTCTGGCGAGGTC
ATCCATCACACCGTCATCTTTGAGCACGGCCATCATCTCTCTCTTCACTTCTCCGTACAGTTCTGGTCGCCCCGAGCGCAGCACATTCTGGATCAAGTAC
GGCAGCACAAATCGGCCCACTTGGACACTCGTAGTAAGAACCATCTCACACGCCTCGAAAACCGCTCGCTCCGGAGGCTGGGAAAGATCAATCAATCTCC
GACACCAAGCTTGTAGCCACTCTTCATAGGTCGATGAGTATCGCTCGTAAAAAGTCGTGCTGGAATACGGCAGCGAAGTTTTCTTGTTCTTCACTGTGTA
GTTCGAGTACCAATATGGCTCAACAAACTCCAACACATCCTTGCGCTCAAACCGTCTCTTGAGCCACTCCGGCATCGGGCTATTGGTTGGGGTCTTCTTT
CTTGTCCCAACGCCAGTATTAAGACTTTGCCCGCCATGCTGAGGATCAGCAGACAAATCGGCCAAAACCATCAGCAGCTCTTGGATCGAAAACCCGACAG
CATCGGTATTTTCTGGCGCCGCTCGCAGCTCTTTCACGAGCCAGTTTTCGATGAGCACACACGCCAGATCCTTTGTCGAGTACTCCATACGAGTTTCTGG
TCGCTCCTTGACAGTCGTCACGCCTGTCTTCGACGAATGTAGGATACTCAATGGGATCCGGGCACCATCAATCGCCCCAAGCGCGCCTAGACACTTTGCA
CACAGCAAACGAATGGCTTCCGAACGGTCCGTCTTGGCCACTTGCAGGATTGCAAATAATACCTCGAGAACGGATGGGTCGATGTAATCCCCCTCCGATT
CCATAAGCTGCCGCAACTCCATGGCACGAAGAACCAATGCATGATAGAGTTCTCGCAGCACAATCTCACGCACACCTGAATCCCAGTGGGTCACGTAGGC
AAGACAACTTGTCAAGAACTCGCTCAACGGCCGTGCGCTCGGGTCACCGACTTCAGATACGTAAGCGGCATACACCTCATCAAGTGCTCGGATAGAAGGA
ATTAGCCGAATTCGTGGAAAGGCATGCTTGAGCTCGGATCTCTTCTCCACAAACAGGTACTGGAAAATGCCGACAGCTGCGGAAGCTGTCGCACTGTTTG
GAGCTTCCGCAAATCCTTGAGCATTGCCAATATTGACAGTGACGCTGTCTGAGCTGACCATTTCGAGACACCAGACACCTGTAGGGCGCATGCCGAACTC
TGTTTGCAGCGAGAATGCGGCACTCGGTCCCGCATGTCCTCGTATACATGGAAGAACGCTGACAACGATCGATACGAAGTTGGATTCCAGTGCTTTCGTC
GTCAACATTCGGATGAACGTGCTCCATGCCAACATGGAATGCTCTTCAAGATGCTTGTCGTATAACCCAACCTTGAGAATCGCCATAACTTTCGGGACAA
ACGGATCAAGCGCTCCTTTCACAGTGTCTTCATTGTCGTCAACTTGTTGGTTGAA