Description :
From Genome Similarity Track
Location :
Scaffold_3300:36- 2741
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3300-snap-gene-0.2Formin-homology 2 domain-containing protein

Sequence
2705 bases(100 bases per row)
GCCAAGGAACACCCTGATTATACCAAGTTCTTCAAGCTTTTAGCAATGGGGCTGCCTGCAGAGCAAGTGAAGATGAAGATGCAGCAAGCTGGCGTCGATC
CCACTGTATTGGACAATCCCGACGCTATCATCGGCGGAGGTCCTCCTGCCACTGCTAGTGGAGGATCGGTGGGTGGCGCTGGGGGAACAATGGTGCAGGA
CGACGAAAAGTACGCGAAGTTTTTCAAGTTACGGAAGATGGGCATGCCGGATGAGCAGATCAAGATGAAGATGAGCGCGGAAGGCTTGGACCCGGCGTTG
CTCGACACGCCTGATGCCATCATGCCGGGGACTGGTGGGTCGACAAGCACTAATGGTTCACAATCTGCGATGACGGTCAAGGAAGATCCTGCATACGAGA
AATTCTTCAAGCTGGCGAAGATGGGCATGCCTGCGGAGCAGATCAAGCTCAAGATGAGTGCTGCTGGTTTGATCCCGGATTTTCTGGATACGCCAGACGC
TCCATCTCCGAACCAGACGGGTGGTGCTCCCAAATCTGGTGGCAGCATGTTGGCAGGCCTACCTGCACCGACTGAAGCTGTGAAAGTGGATCCGTCGGCG
CTACAGGCAAGTCTCGCGTCGAAGCTGCAACGAGGTGGTTCTTCGCAAAAGAAGCCTGAGGAGCCCGCGTTACCGAAAAAGGAAGCCATCAAGCCGAACG
TGGAATTGCGGCCATTTTTCTGGACTCGTGTTCCTGTCAATGTTGTCAAGAGCACGATTTGGATGAAGCTCAGCGACGCGAATGCAGCACTTGACGTTGA
CGAGATGGAATGGATGTTCCGTAAGAACCCCGCTAACGAAGCCGACAAGAAGAAAGATGATGCCAAGAAAAAGGAATCGAAAGATACAACTCCGCAGCTC
GTGCTTCTGCTGGACCCAAAGCGTCAGCAAAACGTGTCAATTGCCATCGCGCGTTTTCGTATGTCGGCCGTGGAGCTCAAGGAGGCAATTTACGCGCTCG
ATGGGTCTAAACTCACATCAGAACTGCTGAACGTTCTCATCTCAATTTCGCCAACGTCGGAAGAGCAAGATTTGTTGAAGAACTACGATGGAGACGAGAA
ACTGTTGGGAAACGTGGAGAAGTTCTTCTTGGAGTTGTTGACGATTCCGCGGTATACACAACGAATCAAGTGCATTCGGTACAAGCTGCAATTTGAAACA
CGTGTCCTCGAGACCCAAGCGCAACTCGACACGCTACAAGCAGCGACTGATCAAGTCGCGGAGAGTGAGAAGTTCCGTCGGGTACTGGAGAATATTCTCG
CAGTCGGCAACTACTTGAACGGTAGCACACCACGCGGTGGTGCGTATGGGTTCAAGCTTGATACCCTTACCAAGCTCCATGCTCTCAAGTCTGTCGACCC
CCGAGTGACGCTGATGAATTTCTTGCTCCACCAGCTTGAGGAAAAGGCACCAAATGTGATTGCCTTTGCGGGCGAGCTTCCCCACATCGGAGAGGCCAAG
CGCTTGTCCCTCGACCAACTCCGTGCCGACTTGTCATCGTACAACTCCGAGTTGGTCATGTTGCAGGCGCAAGTGCGGGCGTCGAAGAGTGACAAAGTTC
CAGGCGACAAGTTTTACGAACAAATGTCACCGTTCTCGAAGGATGCAGCCGAAGTGTTGGAGGAGCTTGGTCGGGACTACGCGGGTCTCGAAGCATCCTA
TCAAGAACTGTTGACGTCATTCGGTGAGGACCCACGTAAGGTTGGACCCACTGAGTTCTTTGCGATTCTCGAAGAGTTTGTAAACGAGTTCAAGAAGGCC
TACCGCCAGAATCAGACCAAGGAATACCAAGCGATCTACGATGCCGCGAAGCAAGCCAGAGAGGAAGCCTCTGCAGCCTCGCGTGCGGCTATCGAGGCTG
AAGAAGCGGCTCGGTTCGCGGAAGAAGAAGCTGAGCGTCAGCGTGTTGAGGAGGAAGAGCGCGCTAAGCGGGAAGCCGAAGAGCAGGCTGCACGAGATGC
GGAGCAAGGCACGACGTCGGATGCCGCACGGGCTTTGTACGCCCAGGTTATCTCGACCGTCACCAATTGGGCACTTAATCATGGCAATGATCGCGACGGA
GCAGCTGCGCTTGTGGAGAGGTTCAAAGCTGTATCCCGAAGCTATGGTGTGGAGGAGATCTCAGCTGACGAGTTTTGCGTTCAAGTGCGAGCACTTGTCA
GCTCAAAGGTGGCTTTGAAGATTATCCCAGTCAGCGCGAGACTGCTCACCAACGCCAGTAAACGAAAGAACCTGCTGATCGCGTTCGACAGGTTTGCCAA
CCAAATCCGGAAGGACAAGGAAGAGAAGAAAATGGCAGGGTTGGAGCGCGTTCCATCCAAGAGGCCACGCAGAAAGAGTTTGGTGCCGATCGTTCAGATG
GAGGATATCGAGCCGGTCGTTGGTGAAGCGGCCCAGCAACTCCACAAGTCAATTGTGGAATCGGTGCAGCACGCGTTTAATGGCGACACCAAGAAAATGA
AGGAGTTCACGACCAATACGCGAAAGTATGGGACCGAGCAAATGTCGGCGCGCGACTTTTACCAGTATTTAACGGCCTCATTTGAGCCCGACTTTGTCGG
ACGATTGGTTCCGGATCTCGCACGTCTGCTGCAAGACACTGAGAAGCGCCACGCGCTCATTCGGGCGCTGTGTGAGAGTGCCCCTGGCTGGGAAAAGTTT
TCCGG