Description :
From Genome Similarity Track
Location :
Scaffold_1695:36- 1862
Transcript NameFunction/comments
Phypl_g13982hypothetical protein PHYSODRAFT_260502
Phypl_g13983hypothetical protein PHYSODRAFT_332166

Sequence
1826 bases(100 bases per row)
aagaagaagacgagggGCGTGCGAAAAAATCTCAAGGCACCGGGATCAGATGGCGAAGATCATGCAGAGCTAAAGTCTACCTGGTCACAATCCCAGTTAG
AGAAGACATACCGGTGCACGGAGCTACACAgccttcttcacgaagaCCCGGTGATGCAGATCCTACAGACTGAGCTGCTGGGATCCCTCACCGGGCCCGT
TTTAGCTCctacaacgacgacgaataAGCTGGACGCAGCCATGGACCTGCTGCGGCTACTGGAAGAGCCAGGTCTCACGGCCGAAGCGTTCGACGCGGAA
GCACTCTTCCAGACAGACTGAGACACCATTCGGGTCTCCGCTGCGTCACTCTTCAATCAATTGAAGATTCTGGTGGGAGAACGATCGAGACCCATAGAAC
CAGAACCAAAGGCTGCACACATGCAGTCCCCCGGGTACCACACTGAATCATCTCGATATGAGTCCGCCGAGTCGGAAGCCGGATCCGATAGCCCGTCGAA
ACCTCGACGGATGTCGCTGGGCCCGGCTGGCGTCGCGATGCTTAACGCTCGCCTACTGAATAAAGCGGGAGATCTGATTCCCGAGCCACGAAAAGAGAAG
CCGAAAGCCGGTCGGACCACGCCAGCGGATCCACCACAAGAGCCGACAGGCCAACTGGAAAGATACTTCGAGACAGCCATGTCCCGCTTCCTGAAGGAAT
AACATACAGCTGCCCCTCCACGACTAACTCCACCCCCACGATCCGGAACGTTGGATGTCGAAATGGAGTCGGTGGGATCGCAAGATCACCACCCCAAGCA
GTGGGAATATGACCCAGACGACCTCAACATGACGTCCGCCAGACGCTTGGCGACGACCGCGGCCGCAATAGCTCCGACAGGCTCGTCTGTAGCCCAACGC
GTAAAGATATCAGCAGTCTCGGATCTGAAGGAATTCAACGGCAAGGATCACGACGAAGAACACGCGAGGGCCTGGATCAGCAACGTTAAGTCCGCATTCA
CGAGAGACCAAGCCCCGGATGAAGAAAAATGCCTCACGTTCGCGGACTTGCTTACCGGCCCGGCAAGAAACTGGTATAGACAGTTGAGTCGATCGACACG
TACGAAATGGGGTGATCTACTCCGGAATTTGCAGACCCAATATTGTGGCCTGGGAATCTCCGTCGCATGGCAGTACTACCATGCACGTAAGCGCTGGGAC
GAGACCGCGCTGGAGTATCTACATCGCCTTAACGTCGCAGGTATGCGAGCTCGATTAAAGATAAAGGACGGCGACGTGAAGTCCCGCCGCGAGCATGTGG
AACACTTCATCGAGACCCTGGGTGACCCCGACCAGGCGGATCAACTCACGCTGCTACGGCTGGCCGACGCGGATCAGCTAGAAGATGTGCTCCGCGCACG
CGAGCGAGCAAGATCGAACCAGAAGAAGCCCACGGGAACTAGCAAATTCTGCCCCAAGTCTAACTTGGCGCCACAGACAGTTCCCGCTTGTGCCGTGCGT
GCGATCCAGATCCAGGACTCTGACCTTAGATCGGATTCAGAAGAGTCAGGATCAGAAGGTGAACTCCGTCGAGCCTAAACGACGACtgcccacgagcagc
atgttgcccctgcgacgacggagccACCCAGAACCTCTAGTCCGAGCCATCCTGGCGCAGACCCAAcaggccagcagcagcaagatccCCGAGGACGATT
CGGTCGCGACGCCCAACAGCGTTGCTCACACTGCGGATCGCGTAAGCACTCGGATCGGGGATGCTGGAAGCGGCTGACTTGTCAGAAATGTGGAAAGAAG
GGACATCCTTCTTACGAATGCCGCTT