Description :
From Genome Similarity Track
Location :
Scaffold_1289:36- 1492
Sequence
1456 bases(100 bases per row)
GACACGGAGCGGTCGGGTAAGTAAACCGCCCACGTGGCTCGGTGACTACGTCTACATTGCCTACGAAAATACAAATCCAGATGATGATGTGAACTCGTTG
CCTGCTGGATGGAGGAAAGCACGAGCTGAGTCGCAACGTGCTATGGCGAACGAGTTGATCCTTGCATGGTGGGAGGACTATTGTTGCATGAGTACTGGCG
AGTTTGAAGAGCCAAATACTTTCGGTGACGCTATGGAGAGTGAGCACTCATTGCAATGAAAAAATGCAGCTGATGATGAGTTTGATTCGTTGATGAAGAA
CGATACCTGGGAGTTGGTGCCGCGTGAGAAGCACATGAAAGTGCTGCAGAATCGCTGGATCTTTCGCGTCAAGTATCTAGCGAACGGAGAGATCGAAAGA
TTCAAAGCGAGGCTCGTGATCAAGGGCTTCATGCAGATTTATGGTATCGACCACCTAGAGGTGTACTCGCCTGTTGTGAGGCTGGAGACACTGCGTGTTC
TCTTGACACTGGCGGCTGTCTGGGATTATGAAGTGCATCAGATGGATGTCACTACTGCTTTCTTGAATGGGGCGATTGACGTGGAGGTCTATATGGAGCA
GCCTGAAGGCTACAAAGTGAAAGGCAAAGAGGACTGGGTGTGCAGATTGAAGAAGAGCCTGTACGGCTTGAAGCAGGCGCCCAGAGTGTGGTTTCAGCTG
CTCAAGTCGTTCTTGGAGGAGCAGGGCTTCACGATGCTGCAGTCGGAGGCCTGCGTGGCTGTTAAAGTAATTGATGGGCAGTTGGTCTTCATCCCTCTCT
ATGTTGATGATCTGATTTTGTTTGCTCCGTCGATGGAGCTCATCAACAAGATGAAGAAGATGTTCGAGGACCGGTTTGCGATGAAGGATCTCGGGGAGTT
ACACTACATTCTAGGCTGGGAGATCACGCGGAACCGGGCCGAGAGAACGATGTTCATTGGTTAGCAGAAGTATGCCGAGACCGTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG