Description :
From Genome Similarity Track
Location :
Scaffold_4351:36- 1247
Sequence
1211 bases(100 bases per row)
GACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGAAACCTTACAACAGGATGTCCTACA
CCACTATCACGCTAGCTTGGAAGGCGAACATCAGGGTATTGGTCGGACCTACTAAACGGATCCGGGAATGTTTTAACTGGAGGGGACTATTCAAGAGCGT
ACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACGGGCAAGAGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCAACTTACCCTTTC
CAAATCATAGCCATGGATCATATCCCCTGTTGCCCAAGTGGTTCCAGAGGAAACACCAGATTGTTTGTTTTGGGGGTGGACCCTTTTTACGCGTTTGCGT
GTTAGCCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACT
TGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAAC
GGGTCGGCCGAGCGCATGGTACAGACGATCACAAGAGCACTCAAGATATACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCC
CCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCC
GGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCTTTGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTG
CGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTTCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGA
AAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGGAAACGGCAGGTAC
CGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGAT
CGCGTCGACTT