Description :
From Genome Similarity Track
Location :
Scaffold_347:36- 1098
Transcript NameFunction/comments
Physo_144946hypothetical protein
Physo_144947similar to Dictyostelium discoideum (Slime mold). Developmental protein DG1037 (Fragment)

Sequence
1062 bases(100 bases per row)
CAATGAACGAAGCTGCAGCGAGTGGTCATCTGCACGTCGTGAGGTGGCTCCAGCAGAACCGGCGTGAAGGCTGCACGGCCATCGCCATGACCCGAGCTCT
TATGCGAGCCCACTTTGGCGTAGTGCTGTTCCTCCACGCCAACCGTCTCGAGGACTTTTCGTTCCTGGGCACAACATTCGTGCGGCATTCGTGCATCGAG
CTGGCGCAGTGGCTGCTGTGCCACTACGCGGACAAGCTCGACGGCTGCGAGTTCGAGGTGCCGACCTCTGACTGGCGATTCAACGAGTGGTGCGAGAAGG
TGAAGCTGCACCGCGCGCGCGAGTATGACGCGTCCACGTGGTGGGTCTGCGAGTCCGCCGCACTCGAGCTCGACCAGCCGTGAATGTGTCCGGAGTCACG
GAGTCACGACAGGATAGCCCCGGTGATATGCCAACGCTGTATTTTGCTGAGATGGGAACTGTGCGTTGTGCACGCGGTGGGGCTGCTCCTGCCGGTAGAA
CGCGCTCCATGCCGCTGCCAGCTTCGAGGTGGCTTCGTGGCCGCCATGAAGTGTTGTCCAAGGGCTTCCCAGGTTGCTCGAGCAATTTTTTCGAAGCGTA
GATTTCGCCACTGTATTTTTTCGTGTTCCTTTTATTTCGAATGATGAGGTACCGGAGCTACTGTGGTCGTCAAAACTTCCCAGCTGCATTGACCATCTGG
TCGATCAAACAACTGCGGCGGTATGTCGTACAATCACTTTTGTGGGGATGTCACGCCCGGACCTCGGAGCTCATAACTGTCGCCGCATCGCCGCCTTTAC
CATTGGTCGGTGTGCACGCATCGCCAGAGCAGACAGGCTGTCCTCGGAGTTGACAGCTCTGATCTCAGAATCCACGTCGGACTAGCAAAAGGCACCGCGA
CACCTTCTCAGCAAGAATGGCAGCAGCGCCGCCGCCGCTCTCGTCGGCGCGCGTCGTGTGCCGCGCGCAGCCTCGTCTCGCGCCGCTCAAGCACGTGACC
GCCGCGGTGAGCAGCTTCCTCGACTACTCGGCGCGCTGGAGCATCGAGTCGGCCTGCGCGCG