Description :
From Genome Similarity Track
Location :
Scaffold_26:359916- 364102
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11110hypothetical protein
Phypa_INRA-310PPTG_11111hypothetical protein

Sequence
4186 bases(100 bases per row)
CGATCGTACATCGATGGCATCTTGGTGGCTGCTGAGTCCTGGGACCCTCTCTGCGACAAGGTAGATCGGCTCTTGGACGCGTGTGACCGGTGGAACCTGT
CGATCAGCGTGGCGAAAAGCTCCTGGGGATGCCGCAAGGTAGATTACCTAGGGCATCGCGTTTCGGCGGACGGCCTCGAAGCTCACCCGAAGAACTTGGA
GACACTGACGACTCTGCCGTTCCCAGGAACGTTGCGATCGATGCAGTTCTTCCTCGGAAGCCTCAACTTCTAGAGTAGGTTCATTGAGGACTCGCAATAT
ATGCCTTAAGAGCTGCGAGAAGTCGACTGCCACGAGATGAACCGAAACCCTGGCCAAAAGACTGGGGACGAAGTCCAAGCCGACGAAGGAGGACAGATTG
CGCAGACGGACGAAAGGGACAAGTGGGATCGTGCGCAGACAGCGTTTGGGATGTTGAAGAACAAGATTGAGACTGCGCCTGTGTTGCGGTATTTCGATCC
AGATCGGGTATCTGTTGTCGTGGTATACGCGAGCGATTGGGCGATCTCCGCAGCCATAGTACAGGTGCACGATGGCACGTATATGTTGGTAGCATTCACC
AGTCGTACGCTGAAGCCCAACGAGCTCAATTATGGTATGGTCGAGAAAGAAATCTTGGCTCTTCTCCGAGTTCTGGACGTGTGCTACTCCACGCTGGTCA
CGAGGCCGATCAAGGTTTTAACGCGGCACTCCACTCTAGCATGACTGATGCGATCTACAGGACTCCAAGGCAGACTAGGCAACTGGGCGGCGCTGCTATA
CCCCTGGATGCTCGAGATCGTCAAGTGTATACGCGGCGAAGATGAGATCCTGGGTACGATTGCGGCGAACATCACACCCCGAGAGAATGTTGATTCGATC
TTGTCGTCTATCGCGCCGAGGAAGCAGCCGCGCCAGCTGATTCCTGTGGTGCTACCTACGGTTGAACAAAGCGAAGAACGGTTCGTCGTGAGTTTTGATG
GATCAGCACGAGTCAAGCGAGGCGGTGGAGTGTGTAGCGTCACTGTCTGGAAGTTACCCGAGTGGATCGTCGTCGCAACAGAATCGAAGTACGTGCTCGA
CCTAACTGTGAACGAGTGGGAGTACTAAGGCTTGTTGTTGGGCTTCAATCTACTGTCCAGCTTGGACCGGGGACGCCTGATTATCTGCGGAGACTCCAAC
TTGGTGATCCGGCAGATGCGAGGCGAGATCGAGTGCAAGGCACCAGGCCTGACCCCTTTTCGCCGACGGACATCAGATCGGCTGAAAATGTGGCCGGTTC
ACGAGTTCCTAAATGTCAAACGCGATTGGAATCAGAGCGCGGATCGGTTGGCCAGCACAGCATTGCACCAACAAGAAGACATATTGGTTACCTCGGAAGC
AGATCGTGACGGTCTGACTGTCCTTAACCGGCTTCAGGAACTTCTGCTCCCGAAGGACGATGGGCCTGTCGCCCGGATGGCTGCGACGACCCGATCGCGA
GCACGTTTGAAGAACGTGCCAGAAGTGCTGCAGCTGGATGTGGTACAACGCATCAGGACGGACCGAAATCTAGGAGCGCAGGACGAAGAGAAGTGGATCG
TAAACCTCAAGGCGTACCTGGCAGGCGACTTGGAGGAGCTGGATGCTGGTGAGGCGGGCTTGTGGCAAGGTCGCGGGCAACTACGACGTGGACGAAGGTG
AGCTACTGTTTTACTGCCCACACACGGGAAGAGACGACGGAGACCGCGACCGGCTGGCAAAGCTGGTGGTACCGGAAGATCTGCAGCACGATGTACTCCA
CCACTATCATACGAGTCTGGAGGGAGGACATCGAGGGGTCGAAAAAAAGTACCAGCGGATTAGGGCACACTTCCACTGGCGAGGTCTGTTCGAGAGTGTG
CAACGATACGTGGGACAATGCGCGGATTGTGAAACCGGGAAGGGGCGTCCAACACTACGAGGAGAGTCGCCGGGTAACATACAAGCGACATACCCCTCCC
AGTGTATCGCGATGGACCGCATCCATTCTCTGCCGAAGTCGTACAAAGGCAACACCGAGCTGCTCATCTGGGTCGATCTATTCTCAGGTTACGTAATAGC
CAAGGCCTGCGCGTACGAACCGCACAGACGATCGCGGAGAGATACGCGGAGTGCGTTTTCCGCAGATTCGGAGCAAGCGAAGCCATCCGGCACGATCGGG
AGCCAGGATTCATGTCTGATTTTTTTTCGCGCCTTCAACCGTATAGTGGGGCAGAGACAGCGTGCCACTATGGCGTACCGCCCACAAGCCAACGGTACGG
CAGAACAGATGGTGCAGACTCTGACCAGAGCCTTGAAGATGTATGTCGCAGATATAAACCAGAAAGGCTGGGACGAGTACGCGGAGCGTCTGACGTTCGC
CCTCAACACGGCGTACGATCGTGTTCGAGATGAAACGCCGTTCTATTTGGCCATGGATGGGACGCTCGATCTACGTTAGAAGCGACACTGCCTCTTGGGA
GCACTCGGCGCCGGGACGTGGAGCCATGTTGGTGGAGATATAACGTCCAGCGACAGTACCAGCAGGCACACAGCTAGTCAACGAGGCGCTGCGCGACGCG
ATCGAAGGGGGAGCAGATCAGCACAACGAAGATGTGAGATCGCATGACATAAAGACAGGAGATTATATGGCTATACCTAGATCGAGTTAAGGAAGGCTAC
GCTCGCAAGCTCGCGCATATGTGGCACGGGCCATTCAGAGTTGCGGAGATGGTCGACAGACACGCTGCACGTTAGGGCAGCAAGCTTTCACCGAAGTCTA
CGCGATCTGCTTCGCGTTTCGTCAGCGTAGATGTCAGGTGATCTGGGTAACTCTTCACCAGTTTTAGCTTCGACACATGAACGATCGGGAACACTCGGTA
CTCCGTGCCGGCGGTTTCCAGCCACAGCTGAGAGCGCGAGATGGAGCGAATTGCGTATGTGAGCTCGAGCAAGAAAACCCGATACGGTCGCACTCGACGC
GAGTACCGGGTCTTCTGGAAAGGCTACACCGAGCCGTCGTTGGTCGACGAGACCGACCCCAACTGTGGAGCGTTGCTAAGAGACTTCGAGCGGGGACGGA
CAGATCGCAACCGCTTCGAGGCGATGCAGTCGTATGAGGAGTGAGTGGTGGAACATCTGCGGTGGGCAGCTCATTGCAGAGCAGCGAGCGGAATAAGAAC
TTGCAGGAAGGCTGCAGGTTCGGGAGGAAGTGGTACATGTGGAGTGTTGTGGGCATGAATAGGCCGGAAAACCTAGGCAATACGCTCTCGAAGATTCTGG
AAGAAAGGAAGAGACACGAATGGATTAGATCGGATTAGATCTTCTCGACGAATGCTGAAACTTACGGGGACTGCTGCCCGACATACAAGGGCATGACTCG
ATCAGCAATAGAAAGGCATGAACTTGCCAGACAGGCGAGCAATCTCAAGAGCCGGGTGGTCAGCTGATACGTCACGATAGTGATTAAGCCAGATCGGTGT
TGTCCGTGATGATCGACGCCTTCAGTAGATCTTCAGGATCGGCCCCGTCCTCAATCCCAGGATACCAAGCACCCGCCTCGCCTTGACGGGGGAAGTGTAG
AAAGAATGGATCCAGCAACAGGTCGAGGTCGCAGTAGCCCTGGAGCATGCAGATCAGCACCTGTTGAAGGAACGACTTACACCGGGCACCGGCTCTGGAT
CGACGCTGCTTGCGATCAGTGTAGAACGCCTCCAAATATCGACTGGCGCGACACTTGGTGATGCTTACCTGGAAGGTGTGAGTGGAGTCCCAATATGCCC
GAAGGTCGCTCGTCTTCGTAAGCCGCATAGATCAGCATCATGTGTCGGAACCAACCTCGATCCCGTAACGTTAGGGGATCGATCTGGGCAGCGAGAACTT
CCCATGGAGCAGATTCGATCAAGTCGCGTACGTTGCTCTCGTCCACTAGCCACTCTCCAAGCGGAGGCGTGGGGTCGCGGAGAGAAACTAACCACTCCAT
CGGATTGGCGAAACGGTGGAACAGTAGATCCACGTCCATCTCCACGATGCTCGTCTGGCAAACGTCCTGGGCAGACCAGGAGACAACATCATGGCCGTGG
GAGCCGCGGCGATCACGATACACGGGAATCCAATCCGTTCGAGGAACCTGGGTGGGCGGCAAGTCCGCTAGCTCAGCGTTGGAAAG