Description :
From Genome Similarity Track
Location :
scaffold_199:35978- 38673
Transcript NameFunction/comments
Pl_107838hypothetical protein PHYSODRAFT_263945
Pl_107839hypothetical protein PHYSODRAFT_467118

Sequence
2695 bases(100 bases per row)
GCGCACCGGTGTGCGCTCCGTGTACTTGCCACAGCACATCGTAGTGCTCGTCCATGGCAATAACGGCTCAGCCGCAGACTTTGACGCTGTGGAAACGGCC
TTATTATCCAAGTACGGTGAGCGCCAAATGCTCATTATCAAGTCTCGAGCCAATGAACCAGACACGTCGTTGGGTGTGGAGATTGGCGGTACGAGACTCG
CTAAGGAGGTTGTGGAGGCCGTGTTTGAGTACGATCTGAGCCCTGCAGTGACCAGCTACAAGTTGTCGATGATCGGACATTCATTGGGTGGCCTCTATGC
GAGATATGCACTCGTCCAGATCATGGATTCGCTGAGCTGTTTGCACGTGGAATACGTGGACTTCGTGACAATCTGCACGCCTCACTTAGGCTCGAGACGA
GCGAGAGGACCATCGACTGTGAAGGTTCGTGGTGTTGTTGTTGTTGCAGTTGATTGCTGTATTTATTAAACGGATGTTGATGCTGGTGTCGATACAGAAC
ATCCTTCGTCTTGGAGTGCACAAAGTGTTGGCGTCGCGGTCGATATACGGACAAACGGGCATTGATCTTCTGCTTGATGGTGAGTTGTCTTATCGCGATG
GTGCATGTTGTCGATCGGTACTGACCGATGCATTGTGGAATATACTGTATCACATAGCACAAGAACAGCAACAGGAGGGAGTAACAGATGCACATGAGGT
CGAACCGCCTCGTCCGCTACTTGAAGTTATGAGCGACCCTGACTCGGAATTTGTCCGCTCTCTCAAGCGCTTTCATCACGGTACATTGGTAGCTATGACG
GATGGTGATGTGGTTGTACCGTATCCTTCGGCTTCCATGCGCAGTTATAGCCCATACGTGAGTACCTTCTTGACAGAGCGTTATATGGATTGGCGATGGC
ATATTCGCCACTCAGGATTCGCTGATGTTGGTGGTGACAGTCGTATGCACTCGGCGTATGCAGCATTTTTAGAGCGACTCAACTCGAAGATTGATACTTC
GATTGAAGTCGAAAAGCACGAACTGGGGCTTGACGCAAGCTATGCTCCAAGATATCCCAGTATTGAACGGTTTGACTGCGACAACAAGCAGGAGGTGGAG
TTTCCCTTCGAGATGCTGTGTCATCTGCAGCAGGTGCTTCCATGGCGACGCATTGACGTGACAGTGGAGCCCTGCGGTATGAAAGGCAAAATGCGTCTCC
ATGACTGGCCGATCAGCAAGATGCAGCCTCCTGACTGCCGTGCGGACGAGTTCATCGACCTCTTGTGCGATATGATCGGAGCCGATCACAAGATGCGTCC
ACTGATGACACCGGATACAGTTGGCAGACTGCATGAAAGTCCAGCGCTCGCATTAGCACGCCGACTTAAAATTGCAGTAAAACGAGCCGGTGACAATGCT
GCGAGTGATCAAGGAAGTGTTGATAGTGATGCTGAAGCACAGCACTCGGGGATGACTTCTCCGACCTCAGCTTCCTCCGTAGCATCGAGCGATGTCAATA
CCGAGCATTATCCAGTCCGTGTGTAGATGCATGTAAAAAACGCGTAATGTATTGGTACAAACTTTGTTCGAAGAGCATTTTTGAAGGTTCACATTGACGT
CCTCAACGCCTTCACTACGTTCAACAACACGTGAAAGTTGCTTCTTTCATTCAAATTCCCTCAAGCTGCGTTGGTACCAGCAATTCCTCGTCCACCTTGT
AACTTCTGCTGCCAGGTCACACGATCTTCCGATGACAGCTCAAATCCTTGTTTCAAGCATTTACCGCTTGCCACTTCGCACGCAGTCTTCAGCACAGTTT
CCAGTGGCTCCCTTCCACATGATAACCCTGTGAGGCTAGCTCCAATAAAAGAATCACCTGCCCCAATCGTCTCAACCAATTTGCCAACGCGTGAAGTTGG
TATGTGATGCATAGTCGAACCCAACACATCCAGGTAATAGACACCTTCGGATCCCCAAGGACAAATAAAGGCTTTTGCTTGGCTTGTCAACTCGTTGCCC
CATTGTTTAGTCCCTATAGCTTCGAAGAACTGTTCTGCGCTTTGAAATCCAAGCTTTTCGCGGATATAGTCCTTGGACAAGAAGGCGTAATCCGCCAACG
ATATAAGCCTGAACAAATTTCAGTACATGATAAATCTGTGAGATCGCTGATGTCAACATAAGGTTTCCACGTTGACTAACTTACTTCATTGCAGGTCCCC
ACTCGTTGCGCAATGCTTCAATCTCAACGGAGATTTTGGCAGCAAACAGTTTTTCGCGCACGTGTAGCATCATCTGCTCAGTTGCATCCAAGTTTCTGCC
CTCGAAATGAAGCCACACCGGTTTGTTCACGTCATTTCGTTTTTCTTCACGATACACAGCGAGTTGCTTCACAAACTTGTCATAACTCAGCTCAGCAAGA
TTTCGCGAGTGCACGATGGTGCGTGACCCCGTTTCGCGGCTAGAAAGAATGTACTGATAGCCACAAAGGTCCTAGCGTAAGAACACAGTTATGATATTTC
CTCATGCTTTTGCCAGACTCACCGAAACTGGCATATTCCCTTCGCCCTCAATGCTCGCAAGCGAACAATTAACACCGAAGGATGAAAGATCCTCGTGGAC
AAACGCTGCATCATTGTCCTTTGTCGGGTCCGTCGATACACCCAGCCAACGGCACCGTCCTCCTAGCTGAGCACACACAACCAGCGCGTTCGCAA