Description :
From Genome Similarity Track
Location :
Scaffold_70:35976- 38604
Transcript NameFunction/comments
Physo_139072zinc finger (C3HC4-type RING finger) family protein

Sequence
2628 bases(100 bases per row)
ATCGGGCCTCGTGGCTCCGAAAATACCGTTGCCTCCCTGAAAATACTCCTCGTCTTGGCTCTCGTTGGTTAAGAGTTATTTTGAGGCTCTCATGCTGTAA
GCCCGAAAACCTCACCGTCGCATCGCCGCTAACATGTTGCGATGACTATTGCTCCTCATTCTCCTTCCGGAGTCCAAGACTGCAGTTGTGCTGCCTGTGG
GTGGGCCGCTCGCTTTATTTCGACGCAAGGAACTAGCAACTGATACGCCATGCTCAGAAGGTAGACTTGAAGCGTTCTGTGCGCGAATACGCAGTCAACA
ATGATCTCATAGCACAACTCTCATTGCAGCCCCGAGCACCACGCGGACGATGACTCGTGCCCTGATCGGGTAACTAATCAAAGTCAGGAACTTCGCCCAA
CATCGTTGCCTGCCCCACTTTCAGGCGCTGAGGTACGTACATTTGTGTATCAAAAGTCGACTACGGTTGCCCACAAGCCTAACGAGAAGCGGGTTCTGTA
GGCTACCCAGGCGCTCCTGAAAGCGAAAATCCGTGAAATTCAGTCGAGCCCCGTACTGACACCGAAGCAAAAAGCCGAATCGGTGCAGAACCTCATGATG
AAGGACTGGAACGACGCGAAATCCAAGGCGGGCACTGCAAAAACGGAATCCGATTCCGAAGCCGACCGCAAGGAAAAATCCTACTTTGTACGTCGTCATT
TGCTTTGTGTCGAGGTAATTTGAACTCTCGTTTAACGATATGTGTCCGATGCTTTCAGGATGAAGCAAAAACGATCTTGGGGTGCAGCCATTACCAGTGC
GTTGGTGGTTGGTTTGTCGTGAACTTGCAGGCGGTGTAGTTGACGTGGCCATTGTTGATCATGGCAGGCGGAAGTGCAAGCTACTGAGTAAATGCTGCGG
CAAGTGGTATTCATGCCGCTTTTGTCACGGTAAGCTGCTGGAGTATACTTGCACTTGCCAAAGTGGCAGCTTGCTAAACTCTTCATTTTTGTAGATGACA
ACGAGGATCACCCTTTTGACCGATATGCCACCGAGTCAGTGTCGTGTTTGAAGTGCGACACGATTCAGGTACTGTTTGTTATACATCCCTGATCAGCGGC
CTACCAAATACTGACAACGAAATCTTTCTTGCCTCGCTGTAGCCGATCGGGCAAACCTGCTCTAACGAGGACTGCAAATGCGAGTTCGGGCGCTACTACT
GCGAGGTGTGCAAGTTCATCGACGACGACAACAGCAAAGACATTTACCATTGCGACAAGTGCAAAATCTGCCGCATCGGCAAGGGCCTGGACATCGACTA
CTTCCACTGCGACCGGTGCAATGCCTGCATGAGCATCAGTCTGAAGAAGCACAAGTGCGTGGAGAGGTCGCTCGAGTCAGATTGCCCGATCTGTCACGCG
TACATGTTCACCTCGACCACGCCGGTCATGTTCCTGCCGTGCGGCCATTGCATGCATGTGTCCTGCTATGAAGAGTACACGCTGGTACGTCGGCCTTATT
GCACGCTGCTGCTGTATCAAGCTGCTAACAATTGTCATTGGTGTAGACAAATTACATTTGCCCATTGTGCTCCAAGTCTCTGGGCGACATGGAACTCTAT
TTCGCCAGCATCGACGAGCTGCTAGAGCGTGAGCGTATGCCCGCCGAGTACCAAGACTACAAGTCGCTAATCTACTGCAGCGACTGTGAACGCAAGTCCA
CGACCAAGTTCCACTTCGTCTATCACAAGGTGCGGCTATTGATGCTGTTAGCCAAGTTGGAGCTGGAAAGCTAACCTCTTGATCTCTGCTTTGAACATTC
CAGTGCCAGTACGAGGACTGCATGTCGTACAACACCAAGCTGCTGCGGCAGTTCAAAGACCCTGACGGGCAGGTCCCCTGCGGCCCCGTCGGCCAAACGC
ACACACACTAGCCCCACATAGGCAGGAAAAATACTCGCCATACTAAGGATAACCGCTGAAGGAAGCTCTTATGAATCCACTTTGAGCTCTTTGAGGCCGA
CAACCTCGTGACCATGTTTGGGCATCTACTGCGTATTACTAGTACTAGTAGTATTATTTTGTTTGTGGTATGTACGACCCAGTTCTTGAGGAGTTTGACG
AATGGAGATGTCGCCGTCCTCTACACACATAGAGTCGCTGGGATACACTCTAGCGCCCGTGGGGGTGACACGACATGCCTCGGCTCTTCAATGCGGCGAG
ACACTTTTCAGCGCCCCGAGCAGAGAAGACCCTTGCACGCGAGCCCTCATTAAGCCCACAGCGCAGCAACAACATACATTTGGCAACACCCTAGTGACCG
CTTCGTGGTCAAATGGCAGAGTGGCAGGCGCGTGGGAGTCCACAGAGTGAACCGGCTTCTCTCATCCATTCACTCTTTTCCAATATTGACCAATCATGTA
TTGGTAACTGAGAATTTCCTGGCCAATAAGGGATGTTTGTACCATTCGCTTCAACTTGAGATGGCTACATTTTGTTGCAGCGCAGCTTTAGAAAGCGGCC
GGCATCGGGCGCTTGTTCCTGTAGCACCATAGCACGAACTGCCCGATCTTGGAGCTGCGGAGCTTCTCGAACCGCGCACGGAAGACCGGATCTTGGATCG
AGTCCATGGAAATGTACGGGGCGATGAA