Description :
From Genome Similarity Track
Location :
contig_8:35975- 37850
Transcript NameFunction/comments
g1794.t1hypothetical protein

Sequence
1875 bases(100 bases per row)
TGGTCGCCCGTGTTCATACTTGCTTGGCCGTGCGGTGGAAGCGTCTTCTGCTGGAACTCTACGAACGCGTGGGAGTTGCTGGTCAAGAGGCTACACTGGT
AGTCAAGCGTCTCGACTTACTTCCTCCTGCTATCATGAATCAACTGCAAGCTCTCATGACGACAGGAGAAGTTCCAGGCTTGTTCTCTCTGGAAGAGCAG
GTTCACCTCGCAACACGCGTCTGTGATGAGCGCTTACTGGAGTTGAAAACGAAGCACGCAGCTCAAGCCGCCCAAATTCGCTCAGAAGCAGAGTCTACGA
GAGACCAGGCGCTGGCCATCCTGCATCAAAAGCAGCGCGACGCACCAGCTACTCCATTGCTGGAAGCCTTCCAGCTTGTGGAAACGCGCTACCAACGCGA
ACTGCGCTCGAAACTCGCTCGCGTTGATCTTCGATGGCAGCAGGATAGTGACGACCTCCGACGTGAACGCGAAGTCGAGAGCGAGAGCGTAGCAGCTACG
GTCATGGCGCTCACGAGACCTCTCGGCGTCACTAGCGGGAAGTGGGCAAGCGCAGTGGCTCGCATGTGCTCGAAACTGCGCGTTGTCCTGCTAATTGACA
AGAAGCACGAAAGGCGCGTGCGCTCTTCGAGCTCAAATGTCTTCGCAACGTGCGATGTCGTGTCAGTGCCGCAGCTCGGTCGCGATTCTCTTCGTACGCT
GGTGTTTGGTCATTTCCACGCTCAGGTCCAGCAGCTACTGGGCGGAAACAGCCCAGCAGAAACAGGTTTGGTCGACTTCTTACATCAAACGCTGCGGAGT
CTCTGGACTCTGGCGTGCATGGCTACCGACATGCACCTCGCTGTGGTCGACGCGTTCTCAGCAGAAGCAACTGCCGATGAACAGAGCCGCCCTCCTCTTG
TGAGAGCGTTTGCCATGGCCTCGATCTTCGCCAAACTCGTAGTGGACGGCTACAAGCGTGAAGAAGAAGCTCGAGCCAAAGCTTCGTGGTTTCTTGATCT
TTCTAACCGCTTGGATCGAGACTTGGGCGCTTTGCGGTCGAGTGATGCCGTCCTCAGTGAGCAGCTCACGACGATCGCCCAACAGCTCACCACGCACGCA
GCAAAGCTGGTCGAGCAAAAGGAAGACGCGGAACGAATACGCACTATCATGCAGCGCTTCCAGGTAGCGGCCGATGAGCAGATTCTAGTCACCAACGAAG
CTCAAGAAGTGGCGCAGCGCGAATTACAGGAACCCATGGCATGTCTGGAGGAAGCCAACCGTGCGCTGCTGCTCGTGGACAGGCGACATATCGTGGAGAT
CAAGTCGTTTGTCAGCCCGCCGCCACTAGTTCACTTGGTGCTGGGCGCAGTGTGTGTGCTGTTCCAGCTTGAGCCGTCTTGGGAGAGCGCTCGACGCTTG
CTGCTGGGAGATGCCAACGTAGTGCAGACTCTGCTTCAGTTCAACAAAGACGCAGTGTCCGCTGCAACGCTGGCAAAGCTGGAAGCCGAGTTTCTTCGCG
ACGAGCGGTTCTGTCGTGAAGAAGTCGAGCGACAGAGCGTAGCTGCTGCCTCCATGGTCGGCTGGGTGCGTGCAATTTATCAGTACGCGTCGGCGCGACA
CCAAGTGCAGCCCACGCTCGATAAGCTCGAGAAGGCCCAGAGTCGCCTGAACCTCATCATGCAGGAGTTCCAGGTAAGCAAGCAGCGCGTCGTCGAGGCG
GACGAAGCCTGGCAAGTGACTCAAGCTGCCATCGATGCTGCAACAACTCGGAAAGAGGCCTTGACGGGTGAGATCGCTTCGCTCGGTGCTCGGTGTGATA
GTGGGGGGCTTGCAATGCAGGCACTGCAGGAAGACCGACAGCGTCAACAGGGAGCAGCAAGTGCCAGCTCCATGC