Description :
From Genome Similarity Track
Location :
Scaffold_175:35975- 37839
Transcript NameFunction/comments
Physo_144267hypothetical protein

Sequence
1864 bases(100 bases per row)
AGGTGTGGGCACGTTCGGATCTAGCTTGCAGTCGATGTGGAAGAGGTCACACAGAGCTCTAGAGCTTACTCCTTGAAACTTGCTGTCGCTTCGCCCCAAT
TGAGGTCGCGGTGGCAGAAAGGAGTTAGAGCGAGTACTCACGACCACTGTTCGTCTTGAAATGGACGAATCCACCGGCATTGACGCCAGTAAAGGGTGCG
GGGGTAAATACGAGTTCCCGACACCTTCCGTCGTGCCTTCATCTTCTTCCCCCAGAACGCTTTGTCGAAGCAGTGGGTGATGGTAAACCGGCATCGAGGG
GTGAACACCTGCGCTAGTGCCGCATATTTCAGTTTGCGCCAGCTCAATCAGCTTCAGCAACTGGGCATACTCGATTTGCATTTCGTTGAGCTCAAACAGT
AACCTTGCAAGACTGTTGAAGCGGAAGCTGGAAAGGTGAAAACCGCAGCGTCGGAGCACCAAGCGCATGTTTTCGATATCAATGGCACCAGAATGTCCAG
GATCGCACGCCTCCAACTCTGTCTGCAGGTCGCCAATCGAGAGCGTCTTCGCTTGCATGCTATTCCACAAACTGGCTGCGAACTCGGAGCGAAGCTCGAC
AATTTCGCGAAAATGGTTAACTACTTCGTTTAGTGTGGTGCCATCCACGCGGAAAATGCTGCTAACGAGCACCAAGTTCCGGAATATCGGCGGTTGGAGT
ATCAAGGTGTTCAGCACCAGCGGCAGTGGGATAGCCAGCACCTCTGCTAGCCCCGAGTCCTCATACACGATCCCGATCTGGTAGGCAACACACTGGGCTA
CAAGCGCCAAATAGAACCCATTGAGCATCAGCAACAGCATCACGATAAAGTGCCAGGACCTTCGTGAGAACCATCGAATATCTATGCGGGCCACAGCTTC
CGGTACCAGACTGCTCTTGTTTTCACCACGTTGACAATGTTTTCGCAGTTGGGGCGCTTCATACATCTCTTGCACCTTTTGCATGGTCAAAAGCGCTTGC
CCAGCGTCCTCTTTGGTCCACGCTCGAGCTTCCTCGCGCGCAATAACTCTAAGATGACTCTCCAGGGTCGGTGGGTCTGCCGCCATCCCAGCAGCCTTCA
GCAGTTGCTGAACACAGGATCGAAAGTAAACCAGGACGGCGACATGCACCGTTAGCAGCGCCCAGGCAAACCCCACCAGAACGATTACGAGACTGCGGCG
CCTGGGTAGATCTGGCTCGCTGTGCTGCAGAATGTCTGTGATACCCTCCAGGCTCCAGGCCACAGCGAGCAGCAGTGCCCACATCGGAGCACCGACGTCA
GTCATATGTGTGATCTGGTTATTTTGCGCCTGCCGAAGGTACTTGGAAAACGGGAAAAGCTGAGGCAGATCGAAGCGAGCGAGGAACAAGTGGCGCAGCA
GGCGCAAATGCACCAACTCTTGGACATCGCGTGCTTGGCTGCTTGTTGCTGAGACCACAGCGTCGGCCAGATCTTCGGTGGAGAGCAGCTCGGCGCGATC
AGCTCGAACGTTGTGTTTCCGCAGGCGCAGGAAGATGCAGACGGTCTGCAGGATGAGCGCCAGCGCCAAGATGAAGATGGTCAGGTCGGCCACCTGGAAG
GCTGTAATAGTAGCGCTGCCCCCGTCTACACTGGGCGCCTCCTTCACCAGCTTGAGGCCGAGGCCGATGAGTCCGAGGATCATGAGCTCGCGGTACGCCT
TGCTCAGCAGCTGCTCATACTTGGCGGAGACGGCGGCGCGGCGCTCCAGAAGGTGCAAGGCGCGCTCGAAGAGCAGCAGACACACCACCAGCACGCTCAG
ATGCAGCAGTACGCGCCATAGCTCCACGACGTCCCCCACGCGGAAGAGCGACGTCCCTGCCATG