Description :
From Genome Similarity Track
Location :
Scaffold_1137:3597- 5402
Sequence
1805 bases(100 bases per row)
CCGTGGACTCGCTTTAGTAGATACGCTAGCGTGTTACCAAAGACAAGTGCACCTTCTTCATCAATGAGCATGAAGTCATCATATTCTATCCACCTCGAGT
AAGACGCCTGCATATTGATGAGGTGGCTAGCTTTTGCTGCCTCATCCACCACGGCCAAGGAATGCCGTTTTGATCGAAGAGTAGTGTCGGGCGTGAACTC
CATTTCCTTGTGTGATTGGACCCATATCGGTGTCATTGTTCCGTGATCCTGCATTGCTCGACTTATCGACTTGATCTCAAGACGGCGCACATCCCGATAC
TTTAAGTGCCGTATGTTACCCTCTGCATACGCTCGCGCTTTCGCGAAGATGGCAATGGCACTTTTATTATCGCAGACTTGATCCCCAGAATCACCGTACA
ATATATTACTACCAGACTATGTTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGGTAGAAGTGACGTCGTCAC
GGTGGATTCTCAGTTGGCCAGTTACGGTATATCCTCCGGGCGACTGCATGGCCGAACCACCGCGAGAATGACCTGGGTTTGCTTCGTACACACTGCCATC
GCCTGCTTGAACACTTACAGCTTTATCCGGCGGGCCGCTCGCATACTGCACACTCGCATCTCTAGCGTTAGCAGTGAAAGAGTCCCTTAATCCAGGCATA
GTGCAGTCTCTTGGCATGCAATTTGCATGATGCCAGCGCTCACACTCGAAACACCACTTTACCCCACGGTAGCGCCTGTATTCGGTGCAAGCCGTTGCCA
TCTCGAGTGGATACCCACTAGAAATGGTGCTATCAAATCTTAGCCGGCTACGAGCTGCTGCTTCCTGAAGGATGCTTCTGTCGTTCACGCCTCGCACCCC
CTCAATTTGTGTTGTAGTCCAAAGGATGATTCGATCCTTCCGGTTTGTTTTCTGAGGCAAATACGTAGGAATCACAGGCACACATACTGCTTCATATTCT
GGCATGAGTACTTGGTGTGTGCGCTCATACCAGATATCACTTCCTCGTGGGCGTTCGTAATACCATCGGATGGGGATAAGCAGGCCAAGCGGATCTCGGG
TTACGTCACCAATCTCTCTGGATCCCAGTTCGTAATGACTAATCGCTTGCCTTGACGCTTCTGAATCTAGCTTTACTGCCACGATCCATTGCCCGATGCC
AATTCTCCTTTGGTACGGAGTCATACCGGTGTGATGAGTTCACAGCCGACATGATGCCGAAGTTCCAACGTTCCAGCAGTGACGAGTTGCGATATCCAGT
GGTTAAACAGCTCATCAACTCGTTTTGCTTTTGCCCCTGTCCATCGTCCTTTGACCTGAAGTTCGGCTCTGCTGAGAATGCGATTACCTAACTCGGAGCT
GATGTCACCAACAAAAATTAATTTGAACGGAGAGTTCCAGTTAACTGCTACGAGGGCGTGCTGTGAGGTCGGGTCTGTGACAGACAGGTCTGGTCACTGG
ATCGCCGTGACACAACTTGGGGAGGTTGTGTCCATTGTACAGCACACTTCAGAGGAGGTTCCAGCTTCGCCGCAAACTTAAACAGTTGTGCTTCCCATGT
CTGAACTTGCGCTGGAGGCTTAATCCACGCTCATTAGTAAACGCAGTGTGTCATTTATTCTTAACTAAATCAATACATTGTTCTTTCTTTTTTCACTTGT
TCGCCTTAATAGCCTTTACATTCCTATTCATATCAGAGGTCCCTTATTGAACCACATTACTGTACTATTTTGATAGTATTGTGGAAACCGATTAGATTAT
CTAAT