Description :
From Genome Similarity Track
Location :
Scaffold_20:35961- 37444
Transcript NameFunction/comments
Phyci_91460phosphatidylinositol kinase (PIK-L4)

Sequence
1483 bases(100 bases per row)
GTCTACAGGAACGGCATCCAGCCGATGTACATCTGCGCGAGGTTCTCCAGCGACGTGGCCTCGTGGATGAGCTTGTCGACTTGGCCCTGCACTGACAGCG
GCAACGAATCAGTCTCCGGCAAGATGCTGCGATGGTTTGCCGACACAAGCGGGCGGATCGCGTCGCCCAGGTTGTAGATGCCGCGCAGTCGGTCATCGAT
GGTCTTGAGCACGAGGCGCGTCTCCTCTTTGGTGCGCTCGCTAGACAGGTCGGGCACAGATTTACCTGAGCCACTGCTGCTCTGCGTGGCTTTGCCACGA
CGGCCCCACTCCACTAATGGATCGTGAATAAATGACTCGAGTACGCTCCGTAACGTCTCCTTGTTTTCCCGAAGGAGGTGCATGGTCACTTCGCTCACGC
GACGGAAGACACCCTCGTAGCCCGTGATTCCGAAGGCGTCGATAATGTTCGGCGTCAAGCGGAACGGCACGATCTCCGGCTTTGCTAACTTGAGGCCCTT
ATCGAAGAGGCAGTCGAAGTCCACATGCACGCACTCACCGTTAGTGCAATCGATCAGAATGTTTTCGCCGTGGCGATCGCCGAGGCCGATGATATGCCCC
ACCATGGACCAAACGGCCGCCGAGCGCGAGAAGGTGAGTCGAGCTTCGAACCATGCCGTCGGGTCGGCAAAGTTGTTGTAAAACCACTGATGAAATCTCG
GTGTGAAAACTGGCATCGAAAGCACTTTGCGACGGTAGTAGCGCGCCATCGCAGAAGGGTCATTGCCGTATTTCTTCTGCATGCTTAGATATCGTTCCTT
GATTTCATGCGTCAACCGAACAGGCTGTATGTACCCACGCTCCGTTTTGTGAATCTGTCCGATGAGCTGCCGCATAGCCTTTGTGTTCCTTACCCACTCC
ATCAGCCCGCTTTCTTCATTTAGAACCACCACCGCGTATGTGCGCAAACGGAGTTTGCGTTTGCGGCCTTCTTGATCCTTCTGTAAGAGTTTGTTGATCA
TCGAATTAAACTCCATCATGCGTGCATCCTTGCGTAGATCACCGGTCTTCTCACGTTTGCACAGGAATGAGTATAATTGCCCATCAGTACCTAGAATTTC
AATGCGCTTGGGTTTTTCCTTGGTCATCATCACATCAGCCTTATCACTGAAAGCCTTGATGTAAATTTGAGCAGTCGCTGAGAAGGCAACGTGCTCTTCA
TCGCGAGGAGCCAGCCCTGTCGCCGGCAAAATTGTGGTGAGCGCAGCTTGAGTTGGTACGAGAATTCTGGTCCGAATCCGACTCAGGCGAATGTGGATCT
TGCGTTGATTGTTACCAGGGTCGTGGCTGGCAAGACTAATCAGCTCTTCGACCATCCGCATTCCCTCGGAGAAGCTATCTCCTATCTCCTTAAGCCCCTG
AGAGAGAAACTCCTTCTGGGCCGTGGAGATAATGTCACGCGCACGATTACGTCGCTGCTGATTCAATGATCTTGAGAGACCAA