Description :
From Genome Similarity Track
Location :
Scaffold_85:35950- 37252
Sequence
1302 bases(100 bases per row)
CATGTAGAGGAATTCCCAGACTTCATGGGGTCTCGGTGAGCTAACACCGCGACTGCTATCGATGTAGCGGTGCGTTGGGTTGAGCAGTGACCAGTATTAC
CAGGACCGAATTAAAGAGTTGGAGGACCAGTTGCATCGAAAGGCACAAGTCGAGGAAGAGCATCGTGCCTTATTCCCAGAGCGAGACAGCTCCAGGGCCT
CATCGAAATTGTCTGTACGGTCTTCTTGCTACGTCTCCAGTTTCGCAACCGAAGAATCCAAGCAAGATACCAAGCTTCGACGGACTCGAACAGTTTTGAA
AAAGGTATGTTGCGTCATATTTACCAGGGTAAAGCACCAAATTGCTGACTGTGGCGTCCACTCCACGACAGAAGGCAACCAAAAGAAACTCGAAGACTGC
TCAATCAGGCGACCGAGAGGCACGCGATCGCCGCGGCAGAGTGAAATAGCGCCACAACGAGAGCGCAATAGATAGATAGACCAGACCGACTGTTCTCAAG
ACATGAGCGCTTTCCCCTCTGCGATGGTTTGAAGCAAATAATCTGCCGCTGGTACTCCCACGACAATTTTGTACTCCTACAGCAGCTCGGTGCGAGCGTT
AGACCGCTAGCCCCCGCCAATTTTTTGCAGGCACGCACCTCCAAAATGCGCATGATCCGGTCTGCAGCTTCGTATCGAGCCTTGATGATCAGGGCCATTT
GACGCCTAGACTGCCGTGATCCTGGTCCGTTGGGGCCGCTAAATTCCAGGAGCTCTGCACCAATGAGTAAGTGAGCGTTAAACTTCGAGATAACAGGCGA
AGCAGTTCAAAGCGTACCAACCGATTTCTCTGCGCGTCTCCTTGGCGATTTCATCCTGGAGGACGTGCAGCAGGTGCTCAATCTTTCTGCGATGACGGTC
GATGCGAGCTGTTTCTGCGGCCGCAGTGGCCTCCTCAATGTTTTGATGACTGCGAAGAAGAGTTTGACGAGGTTTCTTCCTCCGATCAAAGTTGTAGAAC
TGCCTGTCGACCACTGCGCAGTGGCGCTCTCTCGCCAGGGCAGTCTGCTAGCAGGTATTAGGCGAAGTGTTGGTGAAACATGCTGCACAAACAACTACTA
ACGCACCGCTGCTAGTGCCGCTTCTCGATCCGCATCCATCTCCCGCTCACGGACGAAGAACTCGCGGTCCTCGGCTGCCACACCCGGGGAATAGTATCGT
GGGCCGAGGTGCCCCACAAAGTGGACCGTGGTGTCAGCCGGCGGGTCCATCGCACGCATGCTTTTCATGAACTTGTTCATGTCGCCCCTGATGCTACGCA
GC