Description :
From Genome Similarity Track
Location :
Scaffold_14:359415- 360974
Transcript NameFunction/comments
g1234.t1hypothetical protein

Sequence
1559 bases(100 bases per row)
AGTGTCGTCCACACATCCCGGGGAAGGAACTACGTTGGCCTACCCGAAGAAGGACTCACCCAGTCAACCAAGGACACGTCGCGAACCTCGATAGCTTGGC
CAGGGGGCGATCGTATAGTCTCATCTCAACTCAAGACCCCGCCAGAGGAGGCGGCAAACAACGGAAAGGGCTATAACAGCACATCCAAAGGACACCCCCC
ACGTGATCGACTTCCCCAAGACCCGATCACCAACAACCGACGACCGCGTGAAGGATACCCGCGTGGCCGTCGTCCCCCCATTCCCCGGAAGGAGCAGTCC
AGCTCCAACAGTTCTGCCTTGGTCACACCCTTGACATCCTTCAAGTGGACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGGCTACAA
GGTTTTTCTGATCACGCCTGATCAACGGAGTACCCACCACGTCTAGACCCACTGACCACACAAGTAAGTCAGCTGACGAGAAATTCGCAGCTCCAATCAA
TCCTCCACACGGATGGCTATCGGTGCTGCAATAGCTAGCGCTTTAAGCTGCGGGTACCAGGTAAGCCGTGAGTACGGCCATACCCTTTGCACTCACGTAG
AGCCGCTGTTCCTTGAGTCCCGTGGCTATACTGAACAAGACTTATTACAAGCACCCAAGCCGCTCCCGCGTCGCATGGTCCAGCGATGTCGACAACGACA
GGCGGTGTCTCTGCCTTCCAGCCGCTCAGAATTCGTGCTACCTTGCGGTTTTCACATTTCAAGTTGAAGGCATAGGCAAAGCCTTTGTTGACTTTGCTCT
TGTCCCACGCACCACGGTCGAATATCCACTGAGCCGCGAGGTGGTCGCCGCCGTTCATGTGTTGGGTCCCACCGTGCCGGAAAAGGTGCAACATCAATTC
CTCAGTAGCGCCATAAGGATCCTCACCTCGGCTCGCGTTCTCGGTCTCAAACCTCTTCTGCGGTGTGGTGCTAATAACGAGTACTGGTGCTCTTAACTGT
GTGGTGCTAGGAAGAGACGTCCGTGGAGTCGTTGCGTTTGTGGCAACAGGAGCTACCAGGACATCTCGGAGAGTCGCCAGATCAGCTGAAAGCAAGACGT
AGAGCGAGACACCAAGATTGTGTGGAGAAGCTTTGGTCGACGCAAGATCAGGGAGCTGGCTCGACAGCGTCGCACACGGTGAGTCTTGCATCACCGGGGC
CACTAACAACGCGTGTAGTGGACAGGTAAAAAAAGCTCTCCTTGTCATGGACATTGCCCTTCCGCCGACTTCCCTCACAACAGGCAAGGGTGAAATACCC
CGTCCGCTGAGACAGTTAAATATTGTTTATGTATATAGCCCAGATTGGAGGACCGTTCGAAGCACTGCCACATTAAGCCCGCAAGACTGCGTCTTGGTAC
CCAGGCGGTGGTGTACGCATAGAGAACAAGAGCTTGTAAGTCCTCCTCAGTACAAAGAGGAGCCTTATTAAGCAAGCCTCCCCTATTGTGTTTCAGACAG
TGTTTATACATAGTACTTCCTTACTTGAGCAAGTCCAACTCTGTAGATACACGGAGGTG