Description :
From Genome Similarity Track
Location :
Scaffold_1689:3594- 5299
Sequence
1705 bases(100 bases per row)
ATTCTTGAACGCAAGAGTCATCAGAGTTATTCAGACTGCAGCATAGAGTGTTGGTCACTTTCAAAGTTTTGTTGTTGCGCACGACTCACTCAGCAAGCGA
GTCTCGAGCGTTCGAGCCCGTTGGCACACAGAAACGGAAAAAATGGATCGCTACGATACCTACTGTCATCAGATCGCAGGTCGCTAGCGTCACTGTTAGA
CTCTTGGCTTGAGTGAGACGCTCGCAGACAGAACAGTCAGCGGATGGCATCAGCGGTGATATCCACAATGTGAAACTGATGGCGAAGCGTTGGACAGAGG
AGGGGCGAGTGCTGATAAAATCAACCGCATGAAACAAATGAAAGAGACTTGCGAGATGACGGCCAGATACGTTGAGTTTACCTCTCTGAGCGGCCAATTT
CGTCAAACGCCTTCAGGCTTCAGGCTGGACGAGCAGTCTTATGCGATGCAGTCTCGTGCGGTGCACCCAAAATGCTTGTCCAGCACCACCGCTTGCTCGG
AGAACTGGCCTGCCACTGCTGTACTTTCTACGAAGACATTTCAACAAGTCTCACGTTTTTGTACAATGGGTTCACTAAGTGGCCCACACGATCAACATTC
ATTCTTCGAAGATTGTGCTCACCAAGACATACACTCTGTGAAAGCGTAAGCAACGTTGCACATAATTGCAAAACAACTATGTTGCACATCAGCAACATCG
AGAAACATCGAGCAACATTGTTGCTGCGTCAAACCAAAAGACTTCGTGTACAATCAATGATGACGCTGTTGCTCGGCTGGTAATCAACCAAGATCATTTG
AAAAATCCATCGCAGCTTCTGCGAAAGTCGAGTGATGAACAAAGTGGTGCCTCGGACATCGAGTTGATGCAGAGTGGACGCGAACTGTTGGACGCCGGTC
GCCGACGCCAGCGGACGTCTTGTGTCCACAACAGACATGAAAGCACCCGGCGCTGCTACTAAATCAACAGGAGCCGCTACATTGCGTGCATTGGTGGTGG
GGAACCCTTGGGATATCCTGGAATCTTCCTGAGCTCAGTTGATCCGCCAGGAAGAAATTTAGTGTGCATTGCGAACCTTTTGCGTTTTCATGCGTCATCA
GTGGTGGTGTTGACTGCTCTTTGCTTCACAAAGGACGACAGGACGCTTATCGAAACACAGACACCGTGCATTTGTCGTCATTCTACCTACGAGTCCAGAA
TGAAAGTAGCTTGCACACAGCTTCAGAATCAAGCCAATCACCTTGATTCTGATATTTCAGCGAACAAGGCTAATAGAGTACGTGAGCATGAGTTACACAA
AAAATGCACAAAATCTTGGTACTTCGAATTGCTAGCATTGCTGCTAGGTGAACCAAATCTGCATGCAGGTTGCTGCTCATACATCGCATTCATGCTTTTG
AGGCGCTGCCAGAGTGGAATGCATGCCTTGCCTGCTTCTTTCTAGTACCCCGTCTCAAATGTCCAACATCAAAGACACAGAGGTCGGGGGGGGGGCTGAG
GTCCAAGCTTTGTGCGATGGTCGAACATGGGATTGGAGAGGAGTCCAACAAACTATTTTATTTGATAAAAACAGAATGCATTTTACAAGTTTATGTGGGC
CACCTTAAGATTTCTTTTTTCAAACAAAGTACATTTATAAAGCATTGTTTATGAGTGAAACCGAAAGCACTTTATCCAAATGGTTGTGGACCACGTCAGG
GGGAG