Description :
From Genome Similarity Track
Location :
Scaffold_51:35937- 37559
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15652protein kinase

Sequence
1622 bases(100 bases per row)
GGGAGCTGATGTCGCTCTTGTGAGACGATGACCAACGTCTCAATGCACTGCAACAAGTCAAGTCGCCGAGTTTCACGTTCCAATCGCTATCCAAAAAAAC
TTTCCGGGAACTGAGGTTGCCATGGAACAAAGGCTGCGTGAACGAGTGAAGGTACTGAACTGCTTGTGCCACTTCGACAGCGATGGAGAGTTTGCTCTTG
TAGACGGAGGAGTCCCGCCAATTCCACTTGCCAGAGTCATGACGATCAAGTGAGGGACCAATCTCATCGTCCGACCGAATGTCGTAGTCGTCGTCACTTT
TGTCGTCTCTGATCAACGCGTGCTTCCTCTGCAGTGATCGCTTGTGGTCTTGGATGAACATATTCAGATCTCCTTTGTCCATATATTCCATTGCAAGAGC
GACACCTTCATCAGAGTCAGTCACCTTGGTAAATCCATAGAACGTAACGATCTGTGGATGTGACAACGTCGAGCTCAAGCGAATCTCCTCAACAAAGCCC
CATAACTCAGCCAATCCACTTTTGCTCTCGAGATATCCAGCGATACTGAGAGTTTTTAACACCACGGTCTTACCGTGGAAAGCAGCTTTGAAATACACGA
AAGCAGAGGAGCTTTCTTCTGATTCAGGTATTGGTGATAGTAGTTCTCGATATGTAACGAGCGATCCGTCAATTTCACTGTGTGGAATTTCTTGTAGGAG
ATGAACGAGAGGGTCGGTAGCTTTCGTCTTCTTCGCTGTGCAGTTTCCTGTTTCCGCATCATATTCAGGCTCAGGCTGCGCTTCTGCTGGTGGATCTGAT
GTCAATAAATGATGGACTTCATCATCTGGTTCCATACTGGTGCTATCGTTCCAGAAATTGTTTGGTCTGGCGCTTCTTGACTTAGTCAGTGCGGCTTGGT
TGCTTTTACCTTTCGAGGCACCACGGACACTCCGGCGTAAACTCAGGCAAAGTCCGTTGACGCAAAGCATGACTGTGAATGCCGAGAGCAAAGCTGCTGC
TCCTATCAAAAACCACGAGCGTCGCTGGTCCAGCGTTTCTTTCAGCGCTATCCGCTCCACTTCTTGGCTGGAAGAGTCATCTTTGCCCCATATGGAGCCT
GCCGTGGACCCACTGGATGCTGCTAGAAGCACATGCTCGTACTTGTCAGCGAATTCATTATCTGATAGCACACACAACATTGTGTCTTGCACGTAGCGAG
GGTTTGCGTTCGAGTCGGAGCAGCTGAGAGTGGACGTAGTGGAAACATCCCACAGTGTCAACTTCTCGAACCTGTCAGCGTCACTCTGACGCACTTCAAA
CTCTTCCAATACACTGATAGTCTGCTCTGTAGGGTCCTCTGCAGTCGTTTGCAATACACGGGCTTCGTCTGGAGTAACTACGGATGCAGATGATGTAGTG
GCGGAGTTTGCGGTGGCGATCAAGGTTAACTCTGTGAGGGAGTCTGGGAAAATGACGCCTTTGATCGTAGTGATGGGGTTGTTCGGCAAATTGAGCGTTG
TTAGCGAGCTTGGGAAGGAAAAATTCTCCAATATAGCGATATTGGCATCGGCCGCGTCCCTGTGACGATACGTGTGAGCATTTCACAAAGTTTTGCAATA
AAAACATTTAACCAAAACACGT