Description :
From Genome Similarity Track
Location :
Scaffold_3:35928- 37313
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.8Tyrosine-protein phosphatase OCA1

Sequence
1385 bases(100 bases per row)
CCGGCATGGCACCGCCCCGAGCACACCGAGCTGCGCAAGCGGGTCATGGTGCGGCTCCGAGAGCACCCCGTGCTGGCCGTGAACCCGGCGCTGCAGCGCG
ACGCCGCCCAGCACGGACTGCCGTCGCTGCTGCAGCGGCTCGAGTGGATGCTCTACCACGCCGCGCACTCGCTGCACGAGTACGCCAACCCGCGCACGCT
CGAGCGCCGCGTGCAGGCGCTCGTGACCCACTACAAGCGGCGGAGCTGCTCGCTGCCGGCCGCAGCTACCCCCTCAAGCGGCGACATCACCGGACGCACG
CGAAGCCTCAGTTCTATCGACGCCGACGAGCCGAGCTATAAGCGCCAGCACCTGATCGACGACACGGTCGAGCTCTCCATCGCGGTCGGCAACCGCCGGT
GCTTGCTGAGCCACAACGTCGACTTGGTCCGATACGTATTCGGCTTTCTTGACGGACGGGAGACGCTGCGGTGCCGCGCCGTCAGCCGCTTCCTGCGAGT
CCACGCGCCGTCGTTCGTGCGCAATCTGCAGCTGGACGCCACCGCCGCTCGAGCAACCGACCTCGACACTCCTCACGTCGCTGAGCTGCTGACAGCGTGC
GAGAACCTCGAGACGCTTTCGATCTGCTGCAGCGCCAATGCCACGAATATCAAGGCCGGCGTCGTGTTCCCGCGCGCGCTCTCTCAAGCCACGGCAGCGA
CGCCAGCGTCCTTCGGCTTCCAGACCGTGTCGGGACTCGCCGAGGCGATCGAGCGTGGCGGCTGCCGAAAACTCGAGACGCTCAAGCTCACGGCGCCATT
CGACTTTGCCAACGAGAGCGACGCCGTGCTGCGCGTGCTGTCGGCGATAGCAAAGCGGTCGGCGTCGCCGCGAACGCGATTGCTCAAGCGACTCGTGCTG
GACGCGACATTCCTTGGCGACAAGGGCATTGTCGAGCTCGCGGGCGTTCTGAACGACCAGCCGACCGCGTTCGCGCAGATCGAGTCGCTCTGCCTGCGCA
ACAACTTTGTGGGCGAAGGCGGCTGCCACGCGCTGCTCAAGGCGGTCTCCTGCTCGCTGCCGCGGCTCCGGTCACTCGACTTGCGCGCCAATATCCTGAC
CAACACGGACGCCATCGAGATCGCCGATCTGCTCGACGAGCCGATCGCAATGGAGATGTCGCGCGTGTGTAGGGAAGAAACCGGCCACGAAGCGGACGAG
AGCAAGCGATCGGATAGTCTGTCGATCCCCGCTCCGCGGCTACGCCGGATTCGACTGGACGGCAACTTCATCAGCTCTGACGGCTTCCACGCCATCTCGA
TCGCTCTCTGTGCGCGTCGCGAAGCGGTTCGAGGTGCGACGAGTCAGAGCGACGGCAGCGACGACGGATATGACGAGGACGACGA