Description :
From Genome Similarity Track
Location :
Scaffold_41:359224- 361558
Transcript NameFunction/comments
Physo_135887acetyl-coenzyme A carboxylase

Sequence
2334 bases(100 bases per row)
GTGTCGGAGGAGCCCACGGCTGCCCACGAGTTCAACGTCGCCGAGGTGGTTGCGATTCTGGACGAGTACAAGAACGCGCTTGCGACGGACCCGCTCGTGA
ACGTGCTAGCAAGAACCCACAGTGATACTATATAAGTATATGAAACCTTTTTTCTTGATGTTGCCAAGTGCGTTGACTTGCTTTTGCTGATCGCAAGTCC
ATATCACCTAGAATGCAACTGACTGAGAATTGATGTTATTACATGTACATCGAATTGATGATTATGTGGGCGCTCACCACGCTTTATTTTCTGCAGCCCA
CCAACAAGTATTTCTACAGTAATGATTTACAAGATGCCGGCGTAGTATTAAAATTAAAAACTCGAAGATGGTCGCTATGTCTGAAAGGCATAACGAGCGG
GCATGTACAGTATACGTGGAAATATGCCTACGTTACCTTTAGTAAAAAAGAATTGTCGTATGAGTGACCGAACCCGGTTCTTTAGTGATTATCTCCATCG
CTGGGGTGCGTATTGCTGAATGAACCGTGAGTGCTGTGGATCGGCGTTTTGGTGATGATGTCCGACTGATTAGTGCTGTACGTTATTTTTTAGTGCAGCT
GCTCCAAACAGCGGTTTTTCCATCTCCTCCTCTGGATAGTGTCGAGGACCTCCCGCTGAGGAATTACCATGATCCAGTAGAAAAGTACTGGATCGCCCCC
CAGGCCGACCGAAAAACAAACTACTGTCACAGTATTTGCTAAGTTCGTGATGCGTATTTATCAAGACGTATCTACCTACTTCTGCGAGACTGGATTCTTG
CGCTGCGTCGTATCGGTCGTCGATGGCGAGTCCGACGTCTCCCTCTTGTCGATTGGTAGACCCAGATGATGTCGATCGATTCGCGTTCGAACCGTAGCTT
CAGGCGCATCGGAACGTGGCTTCTCGGTTCCCATGTAAGCTCCCAGTACCCAACCCATTGAATGAGATAATATACTCTTACGTTGATCCACCTTTTCGCT
TATATTCGCTCTACCTCATATAGCTGCCCATCCACGCCTCTCTGGGCCCTTCGATTGCTTGCGAAGAGGCCACCCCCCTACGTCGTTCTTCTCGGAGTCC
ACCCCCGACTGATGATTCTTCCTCTTCCTGCTCGTCGGTGTCTTCGTCGCTGACGTCATGAGCGGAAATACCGGGATTCAGTCGGAGACAGTAAAACGAG
CCGTCCAGGCGGCGCTGGATGTTCCGGGCGTGGCACTGTCGTGGGTTAAGGCGTGGCATTGAGCACAAAGCAGAATGGGGCTTGCTGAAGCGCTGAAAAT
GTAGTTCGCAGTCTATTTCTATTCTAAGTGTTGCCTTAAAATAAATACAGTAGACTTCAACCCGGAGGTCAGGTTGTGATTTGGCTAAATTTAACGTAGT
TAAATTGCAAAATTCAGATTGCAGATCAACGTAGCATATTGCACCATTGCGGCTTAAATTGTACAAAAAGGGTGTACCATGGAGTGGTACATTCGTAGAG
TTCCTACTCTTTCTAGAGTTTAAGAGGTTTTCACGAAATATTTTACTCGCGTGTTCTTAGGGCACAACACTAGAGATCTATCGGTTTAGATTTTTAATAT
ACCTTACCCAAATATGACTCAGCAACACTTGCATATTTGGTTAGAATTGTCGGAAAGCACAATATCTATTAATTATGAAGTGTTGTTTGTCAAAAAAACA
GATCGATAAAGTATAAATTGGCTTTGCCCGACGAAGCTTATTCTTGTCCCCACAGCGCGTTTTTCACAATCTTTCGCTTGTGTTGTGGCCTCTTCCCCGG
CTTCAACCCTCTTTTACCAATCCGTTCAGGAGTGGGTTCAAGTTGTGGAGGAAGAATTGTGTCGTCCCGCTGTAAGGTTGCTGTTGTCGGCCAAGGGAGA
AATTTGAATGTGTATGTATCGCGGAAGTGCTCGATCGACATACGCTTGGCGTCATACAAGTCTTCGATTCGTCGGCCATCCTTTGAAGAAGCGCAAATTG
CGTGGACACAAGGGAACATTTGGTCTTGCCAATTGCCGCACGTGCACTCCAGCGCTGGCAAATCCACTACCAGGTCTGGGTGCACATATCCTGGTATGGC
AACAGGGCCCTTGAACAAAACGCTGTACGCACCCTCGAGAAGGGGTGTAAACTCGCACATATCAGCTGCAGCTTGGCGGTCTGTACGTCGCTCTAACAAC
TTGGGGACTAAATCCGAGAGTGCGCCAGATTTTGTCCACGTTACAATCAATTGTCGCCTTTTGGACATCAGTTGACTCAGCTTCAAGAAGTACAAGTGGA
ATCCGTCCAAGGGTTTGGCAGTCCGAAGCTCTTT