Description :
From Genome Similarity Track
Location :
Scaffold_558:3591- 6058
Transcript NameFunction/comments
Phyag_g6613hypothetical protein PHYSODRAFT_471270

Sequence
2467 bases(100 bases per row)
GCTGACTGTGCGGCACAACGCTTTGCCTCCAGCTCTATCTGCGCTTTCTTGGTTTTCGAATCGCTATTCGGTTTGTAGTTGCGATCGAGAAAGGTTTGCT
TGTTGTGCTTCGCTGCAAGCTGCTTTTCGTACTGAACCTGTTTCGCAGACTTGGCAATCTTGCGTCGACTAGTATCTTCGGCCGACCGCTGAGCGTAAAG
TTGTTCCCTTTTCTCTGCTTGGGCGCGTGAGGCTTCAGCCATCCGAGAAGTAAAGCTATGCTCAATGTCCCCCCACGCGTTCAGAAAACGAAACTCGACT
CCACACATTTggcacttcttcttcttgtcccTGAACTCGGAGTACGATTGGGGAACACCACATCGTGGGCATGACTTTTTATCCTGTGGAGGGGAACATG
AAGCGTAAGAGCTTGGAATATATTTTTCACAACACCGGACAGCATACCAGTCGCGCGTTGTAGTCGTTTTCTCCTCGACTCAATTCAAGTTTCTACGAAG
TTTATTTGCCATCGTAAGCGTACAAGTGAAgaaataataataaaaaatGCACTACTTACTTTTTGCCGATTCctttctgcagcttccatTCGAGAAATAA
AATTTTGGCCGGACTCGCCAGCACTGTCGAATTCATCTCTAGGGGAGTTTTTCGCACGTTGAGATTTCCGCACTTGGAAACGGCAGTGCtgttcttcgtc
atcagTGGCGAACTTGCGAGGCGTCGATTTCTTGGACGGCACGGATAAAGTTTCGATCCTTTTCTAGAAATCGGTCAGCAGAACATCATGATTAGATTTT
CATTGTGTAGGTGGGCTTACGATACCTTCGTCACGCACTCCGATTGTTGCTGAAGAGCGAAGGGCGTACACAAACAGTTAGCTGCCGTTTACACTCACCA
CACAAAGGTTGTCCGACTCACCAGGTGGGGCAGCTACGGTTTTCTGTCGAAGTTTTTCGATGGCTTTCGAAGTCGTCCCGGCTTGAAGCAGTCTCTCCTC
GTAAACTGCAGATTTCTTAACCCCGAGCAAAGTAGAAGTTCGGGCGCTCAATGCACTGCGTGAGATGGTTGTGATACCATCTTGGCTTTTATAAATGCCA
GTAGACGATGCCATCGTTGCGGCCGATGGCGACTTGACGAGTGTCAGCGACTTCCTGGGGTCTGCGAGAGTTGTTATCCTTGGCGAGGATTTTGCTGGTT
CTTTTGCTGCATCATTCACTTGGCTGGTCTTCACGTCTGCATTTGTCGGGATCGGTTGTAAACGCCCCTCAACTTGCTGAATAGACTGCACTTTGGCTAA
CATCTCGGCCAGTTCTGCGTCATCGCTCTCCTGGATATCATCATCGTCAAGATAAACGTTCGCGTAGCtatcatcgccatcatcgtccaTTTCATTAGAA
GAGTGCGCTCCGTTTCGATTGCTCGTCTATTTCTGCTTGTCGTACGAAAGCCATAACACCTGCTGTCGGGATTGCCGCGGACACGAAAGATGCTGACGAA
GCAAGATGTGGATCAGTTGAAGGCTCAGGTGGAGCTCGCGATGGAAGTGCTGTTACGTGCCGCGGACGAGCGCGTCAGCTGGAAGCAAACTGGAGATGGT
TCATCACCCGGATATGCTTGTCTTCCGGGCGTTTACACTTGTGTGACGCCCCAACTTACAGCACAGCAGCCCCAGGACCAAGATGATAGTTCTCACGAAG
CGGTCAAGGCAGCACCTCTGGAGACTGCGACGTCGTCTAGGTCATCAATCACACATACACCACCGCCGCAAATTGCAGCTGTCACCTCGACGGATACCgt
cgctggtgaaggagacggGAGCAAGACCCGAATCATACTCCACGGTGACAACACGTTCGAATACATGTGGACCATGAGGCGTAGCGGTGCGCGGGCGATG
GAGTTTACAGTGGAAATGGAAGGGAGTTGGACCAAACCGGTGCTGAGTCGGACTCGAAGAGGGGAGGAGGATCAGCGCATCTTCCTGTCAGCAAAGCGCA
TTCGCTTTCAGCGTCTGTCGAACTACGGTACGATAGGGCCCCAACTTGAGTGCTTGTCGACTAACTCAACATTCACTTGATGctttgttggtgttgcttC
TCAGACACGGAGAACCAGACTTGGAAGCTTTGTTTGAGGACGCTCACACGCCATAGCTCCGACTGGGCCAACGTCGGGATAACCGAGCGGGGCGTACCTC
CTATCGTTATGGTCTTCCAGTGTGTGAATGGGTCATTGGAGAGCACAGGGGCCGCTCTACCAGCTCATATCCTGTCAAACTCACCCGCGTGTCGAATCTT
GGCGGGTCTCACCAAGAAAATCGCCAACAAATTGGGCGCACCTGTGGACGTGATGACGGAAAAGTGGCTGCCAGCCAAAGGTGTGCGGCTAGCACTAGCG
GAGGACAGCAACGGTGTGACAGTCAAGCGATTCAATCCCTTCTATTGGTACGTTGCATTGTGGTCTG