Description :
From Genome Similarity Track
Location :
Scaffold_40:359034- 386509
Transcript NameFunction/comments
Phyca_LT1534571063Hypothetical protein
Phyca_LT1534571066cytosol aminopeptidase putative
Phyca_LT1534551102PREDICTED: WD repeat-containing protein 16 isoform 2
Phyca_LT1534529224Fbox protein putative
Phyca_LT1534508971Hypothetical protein
Phyca_LT15349669RPL13 protein
Phyca_LT15349670folate-Biopterin Transporter (FBT) family
Phyca_LT1534551109PREDICTED: protein AATF-like
Phyca_LT1534508974Hypothetical protein
Phyca_LT1534508976PREDICTED: ankyrin-3 isoform X3
Phyca_LT153441600loc549482 protein, related
Phyca_LT1534119984conserved unknown protein
Phyca_LT1534571082TBP-associated factor
Phyca_LT1534551118predicted protein

Sequence
27475 bases(100 bases per row)
tctacgagtctattcggcggggttctttctggaagaaaagtggcggtggtaattctcgtggcaagaacagatctcccttgatgacagcggccggcacatt
aaactgttgagattcatgtcttgaagatctgcgccgtggacttgctgtaccccttcgagtcgtgctgctcttacggtaaaacacatgaccgtcgacatta
gaatgcttaaactttgtctcgatcggctgcttggctgaaatgctgctgcaatacggctccaactctgccacttgctcagtgagttgggattcgccacatt
gaacacctaagtcaaccttctccagtttcttcgtgtcttcctccaacgtgacttgtttgtgcgcatccattgatgtgctgtggagatccttcaacttgac
tgcacctatatcaacagcagtcgcaggctgcacaattgcctccttttcaacagttttcccacgtggacttaactgttgcgacctgttcacctggacaccc
agcgcctgtttcaagtgcggcgctagagtcttccccagacacgacaacgtcacggatccagtgaccctcccaacgattgcattgtggtggtctcggagct
cccacgtgccgttctgacttgcccactcgcaaatacgaagcaacgcactgcaatccgacaggtcgtcatccagtaaccctacatggagagacaaaggcac
agaggcaaagcctcgaagccgcgctctaccatgctccttagcgagtagaagcaatgttaatgggagctccacgtccctctgcaattcgtgtgccagctcg
ttcggatccgattcgaaaagacaagacttgccatgacgaaacctcgtcgctgcagcttcaataggaggtgtacaggcttcagggcaagtcaacgtggcgt
cgaacacaacaatttcatactccaataattgaaaagcaagaaggagcgagtttgaaactgctggagacgtcactggggcttctaacgcgacatggtcgat
atataattgaagcgagaacagcagagatgtactgagtgggcttacagacgcttcagagtcgcaggaagccaccgacactaaatgcacgtgaccttccatc
ttcaagtttcaaatgaccatcactctttgaattcagattagtgacagtttttataaattgattatctttatatattgcattattttcgttgctataatat
taaatgtcaaagtgacaaccgctttggatatcatacaagtgcgtcactaccccacattatcctaacaatgctcagtcgattcttcagctcttcgtcgtcc
tcagccgctcaccgcttggtgcagcagcgtgttcaaggccaagtatctttactgtccaaggacttagcaacgcctactacccgcgtggtgtttgtgtcgc
gttcgtctgcttcggatctgcagtcttcgctcccattccccgtgtctgccgccgctctacgcgacttcaaggccaagccacaggagaagctctatctata
tccaagtgtggatgatgcggctgttaaggaccaacgtgtgttgctcgtggggttgggagatgcggagaaagtgacgcctaatgtcctacgtgacgcgacg
catggagctctgagcgtacttaaggccaaacgcgccaaagacgtcgtggtgcaggtgcctaaccttgaagggtgcaagatggacgcctcccgtgtggtag
agctgctgtcccaggcctccatgctgtccaattaccagttcgaccagtacctgaccgactctaaggacgccaacggagacagcaaactgcgtctgcccct
cgaacagatctatttggacgcatcagcagagttccagaaggtaaaagattgcggaagcaggagatgataacggagactgacacgttcttgctgtagaatg
tggaggagcaggcgacggtgggcgaagaaacgattttcgcacgcaaccttggtaggtagcagtagtagcactacgaagagtacctagagttgaatattga
gtgtgttctttttgttttgcaggcaatgaacgctcgcacattgcgaacccagcctttatggaggaggtggcacgcgcatctgctgaccttcccaatatgt
cagtccgggtgctgcagcaagaagacctggagaaggagggtatgaacatgttcctgagtgttggtcaggctggagtgtgtcctcctcgtcttgtgattct
tgagtaccgtggcaacccagactcggacgagaaggtcgcgctggtcggcaagggtatcacgtttgacacaggaggcttgaacctcaagccaacgggctcc
attgaagacatgcacacggacatgtgcggttctgctgctgtgcttggcgctgttcgtgctgcttcccgccagggcctcaaggtaaacattgtctgtgccc
ttgccctggctgagaacgcgatcggatccaaggccgtgaagccactgacgatcgtgaagtcgcacaagggcatcactgtggagaacaacaacacggatgc
tgagggccgcctagtgcttggtgacgcaatgtcgtacgtccagaaggaatacaaacccaagaagatcatcgatgtcgctacccttactggtgcgtgcatg
attgctctgggagaacactgcgctggtgtgttctcgaactcggacgagtttgccaagaagctgcagcaaactggaacagagtgtcacgagcgctgctggc
acctgccgattcttcccgagcacactgcagcactcaagggttcgcagtcggattctcgcagcactggtcgtaatcgctatggcggtgcgtctactgctgc
agctttcctgcagcaatttgtgtatgagggtgtggactgggcccacatcgacatcgcgggaccctcgaactacagcgctgcgaagtcatatttccctaag
ggtgccacgggctttggtgtccagttgctctacacgtacctgaaggagcacgagcagcactagagggtcagtatcctgttattgactggaaccctgtgag
cttatctacgtcgtgtttgttgttactcaatagaatggcaaatatgaaaggtatgttgaagttattggcttactactgttccgtgtacaggttccagacg
aaaacacagccgtcgtcgcctaccgagattaactgtcggtcatccggactgaaagctagaccacgtacgtttccagagtgcccaacaccgtccatgatta
actggttggtgctgtagttccagagtttcacgagtctgtcgtttccaccggtggcgaatacttcaagattgtgcgccacggcaatgcacgtggcttcttc
ctcgtgggccctctggatcacagttactggagtgtcaatgcgcagatcccaatacgatatacgtttttcctgaccagcgctcagaacaagacgctgatct
gaagacagcgcaacagtgttgatcccgcccatgcgctggatgtgactcgaaatcctacgttcaccgcgtaaatcccagcacaatagacttcggtctcgac
tgcaggaaatgacgtgcaggtcatcacgatacagcgctaaacttgtgactgccatcgagtgctctttcaggtgcgagaccaagtcgcgtttgcgaatatc
ccacacacgtacttcccctccagccccagctgacactatgaagcgctgattatggctcagagcaagcgccgtgactccaccagtgtgagcattgtcaatg
gaccaagccatctcgccagaatcactgccatgagaacgaatacacccgtcagtccaaccagaaataagcacgtccagcgaatactgaagagaggttggaa
caccggcatctccaacgaagcagcgggtcgcgacggtgtaatctgaggcgtcccagatacgaattgtgcagtcccgacagatggtagcgaatcgatccga
cgcttctggggcgtaggctatctgcacgacggcatttgagtgattttcggacagcaacattgacttcattgtgcgttgtgacgttccgaagttaagacgc
accgaaaaaatacttccagcttgggtaccagcaaccacctcattctgagctgcattgagagtcaaaccgacgaccccgctgtcgagacctacatggcagg
tatcaacgaagtcatgtccatagtgaacgacacttccatcacctccacccactaaaatgccgccattgaagtacaaaatcgagttgacaccgcaggaaca
cgctgggaccaccttgaagagctgccgggtcttgacgttgacaacgctgaaatctccacttgaactaccagccaccaaaaactcccgatcaggcgaaaac
tgtacgcaagtgtaatcgcgaatgagtgtctgctcaatcttgtgctgcgtgagctctccggtggaaggattgaggacccaaatctgcagcaatcgatgcc
caactgttacaaactggtaattaggtgtgtctcggcgctttacgtcacgcgccatccctccgaatgacaccgcagtgacgatgtttgccatcttctggtg
tgtggcacagatattccctgtcagaacgtcccaaacgtacaaccttggtccgtcttcaggtacccccacagagcacaacagtcgttcgtcatctgaaaat
gcaagagctgcgacacctgcgtcatgttccgacaatcggaaagcgagtcttcgagtagaataatcccacacgaggacatccgcacatctgccgcgctcac
ctgaggctaacattctcccagaaggtgacatagcgatgcacgatacatttccttcatggcctcgcaggaaaagttggctgtgcgcgtcttgaaacgaagt
gagcagcactgatccgccggcaggatacacgtattctcgtccggacggatgataatgaatggcgtttggtacagcagaaaatccaatggtgtgctccagt
tcaatcacggtgttgtgcttcggctgcatgtcgaatcgttgatgcggggaactcgacgttgcagagaatcctctcgacttaggcttgccatccatgaccg
gaaagtcttcgtaaccacgtgcattgttgccaccgtcgtactgcattgtcgatagcacaagatcacgagcgggttcctggttatctgtaggggtacaaca
gtgaccgacagaggaaacgaaaccactaaaactaaaagcatataacgttatcctaaagttacctacgaaagggctgccccggtctcaagaagccccgtga
cgccaacatagctcaagcacgtatagtacggcggaaggttgttttcctccatccaccgggctacatcaacgccgatatcttcctgtcgctcgaacaaatt
caacctcagcacccctcgagagagaaaaatccgacacgggagctcgaacgtctgcatctaagacaaagtacaccaatcagcgttagtttcactccaccta
gatccaatcaatcctcaacaccttcatatccttgacaatattgaacttcatcgactcgtagacgagcattccggtctcttcactatccccaagctcatag
agcgaaaaggatactctctttggagagtatgtggggctgccagggtaccaaaagacccggtagggcacaacctgcacgctgttgacgagacagttctcca
acaagttgtagtcgagataatccatcgtcgaatgtccccaagtcgaagcactacaattcaccaaacgtcaacatctctccataaatcctccttcaatatc
ttcaatacctgctccaatagcaaggtcttcctctagcacatccacattcctgctgcagcctcttggcgatggcctcaaaggcgagcgggtcatctgccac
cactgttttggtcagtaatgccactccaatgccgcagtgcgacctagtcaacgtgttttccgctgactcattggtgtgatccactgacgagcactctgtt
aataaaaaacaatattagaaaagtaaataacaatgcagcatttgcttttttatacctcggacttgacgtagcatggagagttcgtcacttacaggactat
aagccaacagcgctagacgtttccaaccagtagagctgcggctgatactggagttcgcatacagagcgacacgctgcgccaggatccgccacgagtctta
ggagaaagagaggaatcagatttcaaatggagacgacacgagtaagcagggacgcaccacaatggacgatggtgtcgcgtatgtggcggttggtaacctc
tagatgcagcagactcgcgtggtctgagaactgcagcgtcgccgctaacagatcgctgggcaattcgcacagccccatcgacttctgattctcgtgtagc
ttctgggcgacaaaagttgaacttgcaaaaatgcaaataggcacgttgatctcctaagacaaagtatctgattttaatcgacaacttaggacatatactt
tacgctgcgactagaacgtcagcattgtcatgctcttcattactaacctttagtcgtcccagcggttcagagcctgacggagcatgcgctggaactgcga
cgtggctgcacgttccttctcgatctccactcgaaggcgcttcatttcgcccacagccttgtacttctgcactgtagtcacctcaccaaagcttcgtcgt
acactcctcattgaaacctgcacagctcgctgttcggcttctacgtgttcttgcttcatactcaaactcggacccacaagcggcttcggcatcgagttat
gtacagcatccagtagcctggatacatttgatccgaagttgcgccagtccgccgggtagtagatggtgatgtcgttcagtgtctcgaagaacgtctcgta
gatctcctcgaagatcttcttccacggcagtaatgtatcggcttcttgcggtgtcacctgacgagttctgtcatcttgtgttaatccctcgtggatggga
agaagagcacagtaaatccgcttcttgagttcgtacgttgatacagcggtggcggctggatacagcagaaacaaacggtcgataaagtcctccatcttct
tgaagtagacgtcgcatgtctggtcacgatctgtcggagaggtctcgacagcgattcgagtgacttcaagtgctgtaagaatcgtcctgatctcgtgtct
ccgctcctgggagttccagccacacggaggatccacaacagcaaattgcagctcaggtggtgggtaggtcagatccattacaccagaggacaaaatgtct
tgacgcacacgcgggaaaacagcacagatattgtcctggataccaacagacgattcgaactggttcatcatggccttgacacttccctcaaggagctcct
tcagtccaacgctcttgaggtgacgaacaggtagagacagtgtagcaaccttcttcagcacttgaccgaacgtttgaggcagaagatcaccagcatcaag
gatctcggtgtcgacgtaggcaatgcgcgtagcgtattggctttgcacccgttccatacaaccttcaagagtgtgtgctagcggtgtccgtgaattcgcc
atttccgctgaggcaaaggccagtgccagcaacgtcacgcggcatcctggattcagcgacgacaacaggccaccaagtcgtcgctcgaacacactacacc
tgtctgcttgttccagtgtactaaggtcaactggcagtagaatcgccgtagttgcagccaacttgttctgttgagcctcaggtgtgttcctatggaagaa
tttcgaatccagatagcgactgcacacagcaacaccctgtgctgccccgttacacgagtaaaaagtacgatgacagtcgttctcgggcctcgagacatcc
tgggctcctgccctgacagcgcaccacaaaccgaacgacgaggtagctccatctaataggtctgctatcaccagtttccacgcgattgacggtgcgttgg
ggttttgctgacgaagaggcccaccaaccacattcagcatgtcttcagaactccagagcgataaaagttcttcatctgacggcgacacatcttctaatct
aggcagcgcctttaatcgcctcgtaccaaccaatgaaccagagcccccattcgttcctttgaagagccactgcaaactgtcctttgccttttgatgaggt
tgatcaagtcgaagcttcgaggcgatggaaactggcccaggaccattgcgtgacatcttaacatacttcgtccacatgtggaacctcagcttcagaacag
caagccgctgcttttcaatgcggcgtatcctcttcctttctgcccgctccttagccaactgtgcttgtcgttgcgcttcgagagcagcttcacgagcttg
tcgtgctcgttcctctgctaactgttgctgccgcagccgctcaagctcttcagcctgtttccgtcgtagttcctcttgccgttttcttcttgtcgacgtc
gctcttcttcaacagcctttatcctcatagcttcagcttgctgcaacgcggcaagtctctgtttctctgcttcacgagcggcttcttcagcttttctgcg
ctgctcttccaactcgcgctgcttcttctgctcgcggagctgggcttccagcgcttcctgcttttgttttgcctcagcggcttccttttcagcttgggct
cgaacaagagcttctttcttcgcttgttcctcacgctgagcagcctgctcatcagcaacctttttagcttgctcatgccgtgtcttctcctccttcgctt
tctctagctcccgcattcgctccagcattgcctgttttttctgctctatctccctttttctctgcgcaatcgcatccagctcgtgaatcttctgatcggt
gccaggcacttgatgttgggccgaagaattgttggcacgatttacttgaccaccagttggaggcgccacgggaactccttcgttatagtcgacaaaatac
gagtaatcgtcttcatacggaggcctgtcggggtacagtttagcttgttcctctcgttcagaatcttggatcagcttgctaagagctgggtattcatctc
gagcatactccgtcactccgcggcatacatctcgtcgtaaatagttgctgtacacatcaagaaaatcggtgagaactactaggccaatagacaagtgcgc
ggtggtctaggcgtacccttgcttcatcccaacgtatatcttggaactacgcgttttcaatggtgtgttgttccgtcgtagctggacatctgcaacaaag
tcagcatttacccgtcactatgtgcgcctctataggcagtacagtaattccaaccagattcgtaccagtttcaaagtcaccgccaaacttcacaataatt
gaactgtcgtcactggcgccagggctaccagatatcctgagttggtgctcttggcacacggagtacgcgtgttcaatgtcgtcaaagcatagcagctcga
ccaagtcttctaacggataaatctggctgcggtacgcacgattcatgcgaagcaaagctgacgaccggacattcgggatataccggaacagcagacatga
ctgtaggtaggtcgcttggcgaagcaacgagaagaactggaaatagtcgccggtatggcgagccacaaacacgcgcatcgcaaacttcatgtgcggactt
tccagaatgtggcgcgggagatcctttacgtacttcaagacgtccataccccggccattatccagcgtacaaaggataaaatacgctcgacactcagcct
cgaatggactcatatacgcgggatctcccaccttgtggctttcatcgtacagttcgtttagcgacttgagggtttgtccaagttgttccatgttctgctg
agccacgaagcttggagtctcaatgagctcatgttcactgagaacgtgataacgtgcaatgcgctcgtgaatatcaagagcgattggatgcactcgacca
ccagcgccacggtaattctggagcacaaagtctttcctgatcatacggaacctgtcccagcagaagttgtacagctcgataggctctggtactcgggggg
tctgaaagcggggatctggcccacactggtctaggtccatgatggcttgctcgatatacaactgagtacgccgaagaacaccaggaggccgaatctcttc
cgcgatatctagtttatgatcagccgaactgcgctggaaacgcttgataatcatgtcacgttcacttcctgggcggtcaggaaagcacttttcgaagacg
cttaactcatccacccgaatatgaagctctcgttctgccgggctacacatatcagcgcaaaggccgtctaggtttgtagctgctgacagctgagccttgc
tgttttcgtctcgcgacgaagatgcagcagacagcataggagcaaacgaagcctcgtcgtcactggtgcttggtgctttcttcttttgtcgaccttgccg
atgttttccaggcttgtcatgcgttgggcttgtctttggtgccactccaaacgcatctccacctggaggaaacttgtttctaggaatgacgtgctctcca
aagggatttccatcttgctcggtaaacccttgactttgttttcctttcccaaatggggatttcttcgagccactcatccgcgcctccatcgacgccatct
tgtcataattaccgaatcctcctgaactgtcaaaaccagattttggtgtagattgtctccgcttgtttgtacccccaaacgtggtggtaggtgcagcacc
agtgggaggtgagggctttccaaatgacgtaaaggcattagaagtaccgcccgatgagctgccaaacgttgtgttgatagctgaaccgcttgaaaaccca
ccactgccactaccggaagcagtgaaaggattatctgcacgtccagaagaggcagattttggggtgacttgtttcttccgcaccttcacacctgacgtct
ggcttccaaatgctgtgcctgatgacgataacggtgctgctccagcactgctaggcccaaaaccgttaaaatcttgggaggaagcaccttgtccgcgctt
cgacatagaacctccgaaggcagtctggccaccaccaaatccattgtcgttgccactgaacgtcgcaccgaaagatccattggtactgtaattcttgggc
tttccaccaacgttagacgcagatccaaatgttgtgtatccactgtttcccgttgaagacggaggggcgccattctgcccgaacggcgtcgacccgaagg
tcgtattcttgttctgttgtgtcttcttcttgccaccgcttttctgtccgaacggattcccactcgatgaaggttcattaaagccccccgattgcattgg
aggggctccagccaagcctccaggaggaagaggtggctggttgccgaatcctcctcccggagcgccagccatgccgcccggaggcagtggaggctgactg
ccgaagccagaactctgtccgaacgtcgtcttggctgttgggccactgttgccaccctggaacgggctcatagtcgttgtggatcctgaacaatgcgaag
gcaccgatcaatatctgcagaatggagcgctatagagccacaagcgagagagtcgacgccccgtccacctgcactgcatgccccatagcaaataaagtaa
acataacccttgtaacctttcgtaccttgattttgcccgaatgggtttccgccttgcgccccgaagcctccgaagccaccgcctcgatctgctcaaaatg
gcagaaaatgtgtcagttcataactcagccaatacaggaccaacagaagagaacgaagactacatagatagctaacaacataaagaacgcactgccagag
ctgaacatcgtaaccaagtccacaggaatctctatgcgtcggcggagatgtccttgttcggtcacgtagccgttgagggaaggagagctggctgtaaacc
ctaaggaatcggtataccggtttaaaacaggtagtcaaaattaaggtggatcagttatattcggaatcatcctagcttaggttaaaatctacgatctgat
tggctgttgcaatttagcatagtgagtccaagtcacttcgaggactggagcccgctgcgcgttggggaaccaccaattctctggacccttgtccgctggc
tgtttgttggctccaagttccaaattgcccgcaactttctgagtaacttcgcgcgaaggtaaatgctcgggcgtagctggcgtctaatgactggagtact
tacgtgctgtatctctacgtagttgaaagatggtgaagcacaacaacgtcatccccaacggccacttccacaagtactgggagtcccgaatcaagacttg
gttcgaccaggtacgatccaatacagagaagcagccaggcagccacacagcaacgcgttcggtctctccattaaagacataacagggagaagaaaaccag
ggaacagacagtcaattcatcaggttgtccggagtggagagaccttcaggaccattttggctggctggctgatttcgagctactattcaaaaggaatagc
ccgctgatgtcctgtgttgtgatgaataaatacaggcttccaagaagaagacccgtcgtctgagacgtaaggctaaggctgctgccatcgccccgcgtcc
ggctgctggtctgctgcgccccgctgtgcactgccccacgatcaagtacggctccaaggtccgtgctggcaagggcttcacgctggaggagctgaaggag
gctggcattaaccgcaagcaggccatcagcattggcattgccgtggacttccgccgcaccaacaagtcggttgagtcgctccaggctaacgtgcaccgcc
ttaaggcctacaaggctaagctcgtggtgttcccgcgcaagagcaacaagcccaagaacggtgacgccgccgctgaggacgtgaagaacgccgtgcagca
caccggcccgatcctcccgatcacccgctcgagcatcaagtcgaccacggctgtcatcacgcccgagatgaaggagaagagcgtgttcacgcagctgcgt
gtggctcgcgccgacaagcgcatcttcggcaagcaggccaagcgtctggctgacaagaagaacgagaagaagtaagcgtcataagcgtcatcttcaggtc
agctctcttgaacgactcgttttcaggaggaatggctcttcttaaggtcatttgcggaaaattggaacacaatacatcgcgcttcaaaaacaaacatctc
ttcatggctgtgcatgtagctgtaggaagagtgtggtagatgatcgttgttgcaacctatatctagctctgtattcatgattccctttcacctttgatgt
tagtatttcttatggcatgagctttctaactctacagtatctcacactcgcacgtctgcataggcttcaggctctgacagcaacggctgcttctctggtt
cgtctggggtcattgaaatcgacttgagcttcactcgacctcctccgacatttgggttttcggacgtgtcaaccttctccggtaaaacgtacaggaagac
caagacgagcaactggcctgcagaagcgattactacgaccagccagagattcctccaatccacaaccttcgtgatcgggtcaggtacgatgcccagcatt
gacaccacaaacgacatgagcactccagacacgacgcctccaaaatccatgaacgaaagatacaacgcgtatgtgagtccttgaacttctgggttggctg
gacaatagtaagtggccacgacaagcaactgcaacagcgcgaactccgaagtgaaagacgtgatgaaagactccgccgttccgaaagtgcatacagagac
tggaaggtccacgatagggggagccagcaatagtcgaggtaatccagcagcaacggaagatactgtcgagagaaggaaaacacttcgaacgctcttgttg
gcacaccacttagcatacgacagacacgagaggaagcgtccgatcatgcctgccaggtacatgtactgcaagcactcgtgctcatcattgaggagcgaga
acgtgtactggtaccataccgttccatcgttaggcagtgcattgcacaagaagaagaagaccatgggtggaaaaacgggtttgataagctccattttgtg
ttgcacgtccctcttgaacggtaaccaccaggacaacaccgtgtttctccatgaggttgttgcaaccacatctccaatctcattagaatgttccgattca
ctgcctgcgaactcaaataccggcgtttccttcagtccaaagagacatacaaccgctgccgtgagtgggaagaagctgctccagccaataacctcctgag
gagtgatgctcttgtccaggtacactggtattcccagcaccaaagccataatagaagctgcattcttcgtcccattagcaaacgactgtacacgagcgct
acttctgcttgtcgcgtctccagtcgtgagatttactaaaaaaatcccgagcatcatctgcgcgaaagcttcagccactgcgtccacgagcttcacgatg
aaagctccagcgatagagtgtacgtacgtagccgtaagaaccaatgatgtagctgcacatacttcacaaatgataatgtacgacttgcggcggtatccga
agagcgggaagctgtcggacaaaagtccgtagagaggcttgaggttccacgggaagaaagtgaccgaatagtacagcgtcgtcgtagctggtggcatgtg
gatgacatcaaagagccacgtaccgtatgccgtggttgggaacgtcatgcagaaggcgtgaaggaagtacagcgtcagcaacgccagtggaatcggcgct
gaagccatcgccattattgctctgccatctgattctgatccattaaggacatattaccacgctttttaatgtttttaacggtactatcccgatttttgat
tggcaaggaaagatatcgtctctgattcgctgaaaatacgcagcatcaattgctacggacacttgaccatcgcctggtgcaggacgcacgaagactttga
ggccatggcacgcgacgagttcaacatcgacgaggcggaagactttgacgacggtacacgcgctgttctgcatgatgacgcgtcggattcagccgaagaa
actcaggactcgacgcgtctgcgctcgtcccgcaagcagcgactacaggcagagcgcaaaggcggaaaacaacgcgaacaagcgtctgctctgcgtgtta
agaactgggacgctgggctgatggagtctgaagaatatgctggcaaagtggtgaagcggaaggatttaagtgacggaatggagtcgcctgacgaggacgc
gatggctcagtggtcggatgcggaaccctttggagcttcggatgaagaagaagaggaggagaagattgaagaagaagaagatagtgaggaggaaagtgat
gaagaggacaagagtgcggagatgctcatcagaggcttccagaaggaggactcggcgagactcatgggtgctcaagacagcgagaaggttgtggagaagg
ctaaacacgtgcgaaaccaaaagctcgtttgggaacgctgtcttgaagtgcagatctacactaagagactgttgacgaccgtcaaggattcagcaaatga
gacggatggagagacaactgacgaagatacagcctcaaagacaaaggagaaggtgctggctgagctctacaacagtattgatgctgtctcagcgctacag
gtgaagctgtgcaacgtcccagagctaaatgctcttgatagcccgacgaagaagcgtaagcgaacgtgcgacgagctgtggcaggagattacaaccagca
accgtgctatgctccctcagtataacgaaatcctcaacacatacacgcgcaagacggatctggcagcaggaggcaaaaacaaccaagccaagaagttcaa
agctgtgaaccaagacatcctcgcgcaggtcgagtcggtcctggttgacccccagcgagtgaaacgaaaggcacacgctccattagacgtgccagaggct
gaggcaacagagggacttgaagatctgctggatgagctcatgtacgacgactcggacttctaccagcagcttctgaaggagtttattgagagtggaggag
gtggtgctggtcaggaagcaatggtgcgacgcactcaccgcaagaagaagaaactcgtcaaccgcaaagccagtaagggccgtcaattgcggtacaccgt
gcaccccaagctggagaactttatgttcccggagccttacccacagccggagatggacgtgacggagctcttccgctcactctttggccaagtccggcag
tagacagctttaatttgacacggaagctgaagaatagactgatgatttgatcgtaaagtgcctgctttgttagcatgcttagagctatgccttctcctct
acagaagatgtaacgccagacttcagtgccgcgttgtgatcaaaggaagacacctttagttcccttagagcacatcgtcttcttcctcctcctccttttc
gcctgatacatacatttccttgatcttcgctaaagtagcttcaatttctcgcagccgtacctcatttacgccctgggtaccgatcttcttcacaataccc
accagtgtcacagccttctcagcagcatgaaccacagccagcgctcgaatcttcttggctcgagttgcattctcgagcgatcgaaactcttcttcagcta
aatccatagaggcgtcagctaagaccagtgctgagtcgatgagttctgtgcctcgctcctcaaagcgctctggaatgttgaatgtatgcagttgccgtac
ttccgccgcatacgagccacttttaaatactttgtgtttgagcttaaccgcgtctttcaagagctgcgtaaacttgtcgatcaattccggtttccccttc
gcaatcgcacgcattgtggcaggagcgtttagaatttgagcacgcttagcgatcaattgaccagcatcacgttccaaaaacgagagcccccacagtcgcc
cgtacgctttaccagcatccagtcgttcttgctctgaaaagtaccagtctcgtgtatccttgttcttgatcaggaggcgggaggaccaggtttgaaccga
gtctgtaccaagcgcaagtccaaattcctccagtttgggggcaatcattttgtagaaagaaatcgcttcttcgtcggtagacaatgccgtagtcaggagc
tctgctactaaacgatttacttcttcgcgattctccacaagtttcttgttgctctcttttcgcgccttcttttccagctgctcgatcatattcatgccac
caggacctttcgactgctgggattcatcaccaaaaatgtcgtcgatggcactttcggctgcagctagctcctgagccatttgatcttctactgatcgcgg
tggcataccacccccacccccgctactaccacgaccacgaccatcacttaagcctcctccatttgatactgatcaattgcgaggaagtaaattatcagca
cagattcacattgctgcacagttataagcgccacctcaccttgctggatgatctgctggtgttgcatgagaatactgaaaagttgctccattgagaatgg
cccagtaggcgaggctggggcttgaacaggcggcttgcaagtacaacaaatatgttacgttagcaagatgatgacaacagtattataccaatccacaaac
ttacaccagggtcattaggagatacatcatctggattatcaagcaggtccgggtccacttcctctgccttcatcttcagcttgatctgctcgtcaggcat
tcccatttggcgcaatttgaaatacttgaggaacttcgggtcatttttgacgtatagcggatcgtacggaacgacaggagcagcagtaggcaatgaggtc
cagctgaaactcccactccctccttgcagtggggatgtaattccatttgtcggatatccggacacaacttgggccggcggcttcatatcatacacgtaca
aacttagtgcatactcatttggattttcaacctcctctcaaacttacaccaggatcgtttggtgacattttgtttgggttgtccaacaggtcggggtcca
cgccttcagccttcattttcgacttgatctgatcgattggcatgtcaatactcttcaacttaaagtacttcttgaacgcaggatcctccgccaccgttat
cgggacgtactcacctttctccggctgcaatcaatagcaaacagcctatgagtcaccacaccaacaacgtttagaacacttgtttacgtacacctgggtc
gttcggagatatcgcgtcgggagtgtccagtaaatcgggactaactccatctgccttcatcttgatcttgatctgctctatgggcatatccatgttcttc
aacttgaagtatttggtcaaagctgggtcgtccttcaccagcaaagccgtataaatcctcgtgggcgccaccatgcttccactttgagcatacgccacgt
tctgcgtcttcttctccagttcactgagtttctcctgtagagccttaatttccttcaaactggctccagaagacctcctctctcttgagcctccggcctt
cttgtctgccatcagctgggagatctgttgttgcagcttatcaatagaagaactcgtgctagcagcatcagatttggatgccaggtcgagcagcttctta
agctggataggagtcagcccagggatagcaacgcctgatcctcctcgacctgcagacagtggagcgtgggcgacgtcttcgctctcggagtcgctttcat
catcttcttcctcggaatcttcttcctcttcctgctctgccgcctccttctccatcctcgtcttgatgcagaagttgcggtgggctcgagcgtgtctcct
cttgcaagtctgtagcaatcagtgctaattagtaggtgttttctgttatttcttagtcttattctgtcgacgcacctcgctgcagtacattgcctggttg
cagatagtgcagggcagagaagcgttgggcgtcgcacagtagtcgcagtcctcgcccgaggccgtcgcgaagctactgcccatgctggtgaggcggctca
tgagctcatcgtcgctgtcgctatctgccatcgttcttggttctgattgacacgacgcttcttggggtctgagtcctctcatgttgaattcgacaaaaat
aacagaaacaggaccatttttttggaacgagattttgatgggctgggaatgcaaattgtgtcaattatttcgtgcactttcatgtaatttattggtaaga
tatgaaaccgtgttagatgtattacacaataaataccgcagagagagaccattgtcccgctcttcaatcgagcgtagctggtctcggctgcttatataga
ttaagttgtttccttggctgcacctcttaagccccgacacgggacaatcggcgctgtgagagcatgcgtaccatgtccggagatttgccggtttcactga
tgttgagcaagtagttcgatcccacgtgctcgttcgtgacgatgcctgagaagcgttggaacaactcgcagatggtggcgtggccattagcctcagcgat
catcatcgcgtcgctgtcgttcttggtgcgcttttctgggtcggcgtcatggcgcagcaggtactcggaaatggccaacgagcccagctttgccgcgaaa
tggagtggggtgatgccactagtggtcatgacattcacgttggcaccatgttcaacgagcatcgatacaatctcgatgttctgagacacaatggctgcgt
ggagaggataggtgccacgtttgctgcatgcagaaatcttggcaccagcatcaactaatagtttcaccacgtcgacgcatccattccggcacgctgcgat
tagtggcgtgacaccagcgtcattggccttgttgacgtcggcaccttcgtccagtagaagtgcaacaatatcggtgcgtcccatgcgagcagcaatgtgc
aaacacgaggaaccgtcggccatcgccgtgttggcatcggcgtaattgaataggataagctgcaccgcgtacgcgtggccgatacggcatgccacgtaga
gacagatctcccagcgtcgagcttgcgtgagttcaggcgagttcaactcgtcgatgtcgctagcgaactgacttaacacgtgctcgcagaactcctccat
gaacgtgtgcattgtgtggacacgcacggtcttgacctgtagagatggaagagtaacgcgctcaggttctgtgcactcctcttcatttcgaggaggcgtc
gaaacgtcttcaattcgagattcgacagcgcgtggggcggtaagatgaatttcgctaagttccggggcttcctccttgaagtcgccatcatcttcctctt
cgtcctgacctagcatttgttcagcgcattgttgtctccatccactcaagaccaacgggcgatgcagggcagccgatgcgtcggtcaggaagagttcggt
agctcccaaaaaattcgcgtacgtcttaagcactaaacagccgtcgtcgtgcagtctttcacgcattgtcgcactggcaaaggtgccgaagaactcgtgt
aaaagcgtaacgaaggcggcgagcgcgttgcggcgctcattaacagcgcagtggtcgagaccagtgaacttggaacggagcgaccggcgcgatgggaacg
ggaacgactgcagcatcgggtacagtgcatcgaattcgcatcggttgttggcacagcggcacttgtgcgccagaccaaattccaggcggcggtggtgtcg
cgtagcttcggccggatcgttcacgcggtcgcgaagtgtcttccagagacggcgaaactgggaataagaccgcagcgtcgtgcagacctcgttgggtgcc
gccgtagctggaactggatctcgggcgtccttcttagtgagcttgatgatgaagaagactttaccgtctgtaacctggtaggagggcactgccacgtcgt
acttatcgatccagctcatgtatgcgtcgttttgtcgagtgttgggcggttggagctctgttggcttgtgtcgcagtgctgataggtgacaagtttctcg
gcaatcagattggtatgagaaagctagttatagatgataccagtaaacggaaggcagttatcgcctgagaactccgctggtggttgagttgcgattggta
cgagtccgctgcaagcagcaagagcttcgtgggtattcaccgtgttggcaaaaacgaaattggagccgtccctcggctgctccaagcacatgatgcggcg
cgagccggcagaccatcgtaatgtggaccgaacatctcgatggcacaccccttgaagtcatctgatctaccaatcgatggcgatcaaatgcttgttttga
ccaatcagctgtaggtccccccttcgcgattgaacgaaaacaatactcgcacgactctgtcaaagcgatagcgtggctggcaattggtctccgttgttac
tgcggggcacaaacctggaggggcgatgaccagggccactaggcggatctggctatggattcgactttcaccttggaacgacgtgtgcaatggagaagac
tactgaaaactgaccgcactgggctgtccagcctgcagcaattgcagccgctcgttgcatccttcgatgacgcctctcgatggagaccacagccctgaag
gaacgtacacttttaagcaaagttttaggactcgttactaacttttgccaacgctttcgggggaggaaaagacgatgttgcttggagcgtgcgactgcaa
cctcttgacagccgatggattttcgcagcgtcccactcgcgtgctgtgcattgccccagccggtggacctgtcaagcgtaaggccagctggcttaaacac
catggtcagtgatgttgaagagcttcagagccgcaagtccagtggagcggctagcaagtctgtccggtgcaccgtgttgagttccggggctgtgaattgg
gcctgtagcagttgaagcgggtcgaatttcttctcgacgcggtgttgtcggtgttcactccacggatggtcgcaattgcaaacccacgggctgcaaaaca
tcggtaaactggatcgtcagcggtggatttttgatgaacaacatcccgaattgtagaatcgctgaaaaaattggcataggatacgcacctgtcaaatcct
cgacaggaacacttgggctttttgcagacaaatggtttgctgcctgggtcatgatcagtgtgcctatgtttgcagcggcatcgtaggatccaggcgcctt
ctgctacaacgtaaaagaaacctctgcaagaacacttgctcgacgtgcaggcgaaagcgcggaaccctgctggagatttcacgcgaggatcgtcgacgct
gctcgggtgctccttgtatcggtggccactgtaaacgtaagcgtgtattaatctccactatgaaatcacatacgatatccaaatatcatctaaaaatctg
taccaaagacatcgactctcgtcgcgaatggggatacattcgcgtttgcatttgtcacaagtcctttgaatcaccatcttggtgtagctcttcatcttca
tcggaaacggggctgcggtgggctgaattggtaacgttgattgtctcttcaactcggagaactgctgcttcagttccgccaccgaaacctcgtcctgatt
gcaacttgtctctgtagttgaagtgaattcagctgataacttcacatcttgagctgctcccggcggtaataaccttgaagtatgcaaatcctcaatactc
ctcttctcttgctgtatccgttcagcttcctcttgctgctgattcggtgtcagatccttcagagttgctgcgatagggcagtttaacttcgatcgccttg
caagcagcttgcttttcaaaagctgtaaggacttggctcgctcggcagaactctgttccattctgcacttaggcgtctcttcaagttcaggatccacaat
gaaattgctccatgttgtattgtacgccattgctacgacaaccggaatgcacacagccgaagcgctggtttgcaatgccggcacgtattttgatggaacc
aagtgctcgcgctgtcctggaggtacattcggcgttatgcctggtctcacttcttcgttgtgctccgggttgtgtacggccggattcttttgcccggaag
gttcgacttcatctcgagaaaagccctgtggcaataccatttactactgcccagcaggcagcgctgcacgtcgccgagtggattcgggatactacacaat
cacttttccaaccaattcaactgacctccccatggttgacagcgcacaaggtggtttcggacggcaaatacgctgtgagaagggatattactgcgtcttt
ggcatccgacgagtttgtcctgctggtgtattcggggagtcgacaagaatgacaacgccagagtgttcggatctctgtccgaaaggttcctactgtcctg
aagctacaaatgtgccgattccgtgtccgcctggcacttttggcagtgacgctggtctaaccaatgctcagtgcagtggactctgtccaattggaagtta
ctggtgcagctcatcgttaatttgatgctgaattgcttgaatctcatctaccttttttgtttgtcttcagtttgcttggaacaatcacaccagttccgtg
tcctgcaggaacatacggggctacaccaggtctgatcagctcagcgtgctccagtaagtgttctaccgtcaatggggtgctttcctgttttccgtcgcct
tgtcaagcagggtattactgtccggtcgggacaaaggtgcaactggagtgtggatctgtagatttgttctgccctgaaggctcgtcagcaccaactgctg
cgtcaacaggttactatacaacgtggaaagtatccgtaacaacactacagtacgtcgagggcaatcggcttgccgtacaaaaccaaacaacgcgatccga
tcagcatatttgcgaaaaaggagcttattgttctggaggagtcaaaagacttgcccgccgggtacttacggcgcaactgaggggttatctactgcagcat
gcactgcgccatgccctgctggtttctattggtacgaatcccttgaagttttccaaattcatttgcctaacagtagcccttcaattgtttgcagcccgat
aggaacagtagactataaccaatacgcgtgcacattgcgagcagaattctgtcgccaggctcttcagctccgacgcctgtagatctcgggtactttaccg
tcgtgacctcaggacgacgtacagatgagaccatttgcccacctggaagctactgcgccggaggagtccaatacctgtgtccggaaggcacgtacggatc
tgctcccggtcttgcgtcaaaaacctgttcaggaaaatgccaagatggatacgtgtgtccaccaggatcttcgtcagctcaggcaactccctgtccagca
ggaacgtattcacggaatggcaagttttgcgcatcttgttctcccggatactggtgtgaggttggatctccagatccccaacagcacaagtgtggtgccg
acaataagtactgcccacttggatcttcagcagcacaaactgttcggaatggctactatgcaacgggccagcagaccgacacccacacggccgagacatt
atgcgtcattcgaaacgcccctcatcttcctcagtgtccttcttgaagaggtgtaagcaaaaacacgtaacaaaacaaacttaccattatcgtagatgta
aatcagcagttaatctagcatgtgtgctggtattacatgcgtggattaagggtgacgcgaattgggctacgtgcaaactttttattgcgtgagccttcaa
tgcgagggtgcattggtggtctagcggcgttctctccaagcccagccccaaagcccgctgcagcacccaagcgaggcgtgttcggcgttttctaagaaaa
aatcaattaaacaaagttagtaagttcatcatagttcctacgtttaaccagcctaccgaatcctgtcgttcgctctcctttgtcaccaattggtactgca
ttggaggaagcctcacgccatattcattcgagatcaatggtagggggatgctattgcgtttgtcggctaactccatcatcagctacaacagtgtcagttt
ccagttactagcctggaggcaatacataatcttctaacagaaaaagttgcctgtttacctcccgaggtggcacttgagcatagtggtggttcagtctcga
tgaaatggcaagccgaatatcttccgggtcaattgtctacaccaaaacaaataaaatataggtagcgttatgctttatcgtccatcaagaccccaacccc
cctttgctttacctgcttatccgcgtacattgagtattcttgggcatccgagaggatttcagtcacgtagcctggaggcaatacatatttaaattaatta
gaaaaagaggcaacaattattgtggcgatgacttacggtgcacaaactcttggagctgcgccacgacacgcggctcgtatttgtctgcgcccatggactc
caacagctgacgcatggacacagaatcaattggctctacgttggccccttcttcgcgctcgttagcgtcgccgtcgtcttcatggagccgcttcatgccc
ttgctggctttgtccatatgtattgctaaataatggcaaaagtggaaatgccacaaattgagaaacaaaaataattgcgaaataaaaataatggaagctc
ttttttacatttttttttaaaatattaaaagggttaatcctttacggtatacctaaaagctcttgaaggtgtgctcttgcggtttaacgcgccatgtcgt
gtactgttgcaactcgtggataaaagcttcagacggcttctcttttgacttgggcatcgcagcaagatcgaactcagagagttcaccaatgtagaattgc
ttgagatagcgaaacgactggcgactggcatgataaatttcaaacatgactgtcgaatccacgttcatggcttcctgagcgatgagctcagaaccgccgg
ggtgttcagggatccaccgagtaatgtccaacaccatcccttgcatgacgagccacacttcgcccgataggtttcgacgaacgacttcctcccaacgaat
agcctctttccgaacgcgagtctcaaactcgccgaatctccgctgacaaacctcctgcaaaccaatgcacccgactgtgatagccgcagctagtagatca
tcagtaactgacggatcaaattgaaactcggtgccatcgtttcgtgcttcatgctcgagatacaataacacccgatcgaatgtacagcaatccacatcca
cgtcgatagtagaagatgcgtccttgtggacacctttgcccgacagaacagccgacgacagcttaatgcacgggaaaagaagttttttcttgacaggaaa
ctcctcctcatcattcgtgagaaccgtgacgacatctgagcgcattgacgtcaaaccggcagagtcaactggtgttacgttcagcagttcaaacgctaga
gactgcgctccttccgacgaaacaaacacttgcacgtcttcatccacccgaccacgatacgagtcaggcattgtgaactccgtttcatcttcatcttgag
catcaatctccagcacgcggacgaaatagtctcgaccgtctttatacggcatcactatcctctcgtgctctgttagcactcgttgccacatgtactttgc
aaacgctgctgcaaattccttcgcatccgtcactatcggagcagcaggtggctgtacagttgccacttcttcgtcgctttcttcgtcttcttgtagcagt
gggcggatctcaatcgccactgcgttggcaatgggcacccgctccacgaataacgtccatttctctgtttgaaacctgcagagttccaagttgatcatct
gcgggtgcgtcaacgcgatggatccaagcggaaccgcatcgtgaggacgaacagacactacaaactgtgcatgcagtctcggatgaattagagctgaacc
atcagacccagccgcgtcgacgggaaagtcgtccgggtgcagcagcgcacaatgacgcaacgctgccaagtggtcggaagcgacttccagctcgtccagc
tcctccacacacagcgacttcgcccagacaagagtgtttgccccttgttgttgctgcttgagacgcagcgccgccgccatggcgggtgcccggatgtcac
ccgccggattattgttggcattccacggcatctttctggtactgcttctggtggtcaggctttaggactgttgtgtgggttgtgtacacaaatctgcgac
ttgtgcagacctcccatccaaaatgattctttcaaaataaacaaaacgagcaggaagctaagagctcaatgcaac