Description :
From Genome Similarity Track
Location :
Scaffold_20:35902- 36975
Transcript NameFunction/comments
Aphas_H257_09117conserved unknown protein

Sequence
1073 bases(100 bases per row)
CTTGAGAATGTCTTCGCATTCTGCCGTGCCGATGGCCCCCAGCGCTTCGGCCGCTTCGTGGCGCACCATGCGGTGTTCCGCTTCGTTGATCAGCACCTAA
AACCGAATTAGTAAATATAAAGAAAAATCACTTTATTCCAAGATATATATATACAATCCAAACAAGAGAGTTACCTCTTTGAGCGCCGGCACGGTCACGG
GGTTGGCCATTTGGCCCATGACGTAGGCGATTTCATGTCGAAACAACGCGCTCGTGTCGTGGAACGCACTCGCCAATGCCTGAGTTGGCTATGAGTATAC
AATTGCCAAGTATATGACGTGGCATCGTACCAGAGCAGCGTCTTCCGTGTTGCGGTTGCGAAGGGAAAACATGGCGCGGTACCGGTCAAACATGGATCGC
GACGTGTCCAACAAGATGGCTTGGAGTTCGTCGGTGGACTTGGACTTTGGCATGGCGGGCGCAGGATCCACCGAGTAATATGGATTGCGATCCATTTCGT
CGGCGGCTTCGGAAGCATCCTGCGTATGTTCACATGTGAGTGAGGAAGGAAGGATGGAATGAATAGGAAGACGGGGATATTACGTGTCCAGCATGTTTGT
ACTTGACTAAACGAAGGGCCAACGCGCACGTCTCCGCCACTTCGAGCGCAGCGTCGTGGGAAAATCGCTCCAGGATGTCAATGGATGATGCGTCTCCGAT
CGCACCCAGCGCCTCGGCTGCTTCGTGGCGGACCATGCAGTCGTCGTCGACGTCGGCAAGCACAGCTTCCAATACCGGGCATGCGACGACGTCTTGGAAC
TGACCGATCACGTACGCCAGTTCGTGGCGCATGAGTTCCGAGTCCTTCTTGTTGGGCAGAGCTACGGACGGACGACATCAAGGACAATCCATCATTGGGA
CACAGACAGCATACCTTCCAAGAGAACTTGCAGGTCGTCTTTACCACCACGGGTACGTAGGTAGAAGACAGCGCGGGTGCGCTTGCCCATGGGCTCGGAC
AGGTCGAGCAACGAAGCGCGCAGTTGGTCAAAAGAAGGGCCGTCGGTCATGGTGGCGGATGTGCGATGTGACG