Description :
From Genome Similarity Track
Location :
Scaffold_1080:359- 2718
Transcript NameFunction/comments
Physo_145344hypothetical protein

Sequence
2359 bases(100 bases per row)
ATGCACACAATCATATCGAATATAAAACCCCTTCCTCCGATCAACGGCCTCCCCGTCGATCCGTCACTCACCAAGGCGACCAGCTCGCCCTGGCGGTCCG
ATCTCACTCTTCTTCGTGAGACTGCATCGCGCCAAATCGGTTCCGGTTCACGCGATCTCGAAGGAACTCGTGTAATAAAGCTCCACAGTTGAGATCAGCT
TCGTCGACAGAGTCAGGCTCGTCGTAACCCTTCCAGTGTACCAGGAGTTCTCGATAAGTCCGGCCGTACCGCGTCCTTCGACCCGTCCGCATATCCGTGA
TCTTCTCCACTTCGTACTCGTTCGAGTCTCGATCTGGGGCCCAGCTGTCCTCCGGAAGTAAGACTTCGTCGAAATCGAGTCGATCTGCTTCGTCCACCGT
GAGTGCGATCTGCGGTCGATCGGGGAAGTCCCTGACCAACTTCAGCTTCGAAACATGCACGATCGGGAATAGGTGATAGTCCGTACCAGCGATCTGAAGC
TTCATCGTGTACTCGTTCACCTTCTCCGCCACACGGAACGGGCCTTGCCACAGGTGAGCCAGCTTCCGGGCATACCCCTCTTTCACATGATCCAGGTACA
GTCACACCTGAGATCCAGCTTCGATCGAGTGCGGTCGAACTTCTTCATTGTGTCGATCGGCCCGATCCGCGATCGCCTCGCGTAGTCGAGCATTCACCTG
ACTTCGAGCCTGATCGTAGTGCTTCTGGATCCGATAACGCCACCGTCGAGGATCCCGATCCCGAGTCCGAGTACTACCCAAAGGTATCGTTGCCTCGAGC
GTCGATCGAGGATCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAAGGCGGCCATCATGGGTGTG