Description :
From Genome Similarity Track
Location :
Scaffold_1383:359- 1902
Transcript NameFunction/comments
Phymu_g13198hypothetical protein PHYSODRAFT_261658

Sequence
1543 bases(100 bases per row)
cagtttagttggtgctgttgttgcgGATGTAGTACGGTGCATCCTGGAACTCCGCCTCACAGTACGAGAAGAGCGTGTCATCGTCCGACGGcgtgaacag
ctccttgccTGCGTGGATCATCACGTAGCAGCCCGTGATGGCGCACACCACAatcaccagcatcgacgCACCCTTGTCCAGGAACGACATGCTCTTCCAG
AACACACGCAGGTAGATGAtcagaggcagcagcaggcagcTCGTCGTGTGGGCAGTGGCACCCGTGAAGTCCTCCAAGTCGAGGAAGCGCTTGCGCGCAA
GCACGGCGACGATCACGAGGATAGCAATGATCGCAATACGAAGAGCGATGTAGCGCAGCGGGTTGTTCTTGTACGGCGCgtgaagctcctcctccgtgat
ctCCTCACCGAACTCCAGGGCAACGCGCAGGTGCGACATACGgccctccgtcttctccaccagacTCGAAGCAGACACCTGACGGTTCGCAGCGTCCAAC
GGCGTGGAGCTCTGCATGTACGAGCGCTTCTCCTGAATTTCAAGGTCGAGGTCAACGTTGGCCTGGTCCAACTCGCCATTGAAGCGGACGATTTCGGGGC
CCTTGTGCATTCCCAAGATCAGACGCTCCGCCATGTAGAACGGAGGCATCATAAGcgtcgagaaggcgatcgaAATGTGCACCTGCATGAACAGATACGC
CATCACCACAGCGCCACGGTCGGCGGAGAAGCCCAGAGGGGCCAGGCCGAGTGGGTCCGACGTGCTCACGATCGAGTACAGGATGTTGCCCGAAAGCTGG
CAGCCGCCGGCAGTGTAACCAGCGAGGGCCACCGCCACGAAGAAAGCTGAGATGAACAGGATGGTGATCACCACCACACGCGGCATGCGCTGCGGCTGCG
AGTGCTCACGCTGAAGGTCGGGCACCACAATGGCAGCGCCGTAGGCCAGAGCGAGGTTACCGAAGCACGTCAGCACTTGGTGCAGCGTCACATCCGGCGA
CGGGATCGAGCCGTGGCCGCGCATGTTCCACTGGAGAACCGATACCGCGATGATGTCGGCAATAATCGTGCCCATGCAACCGGCGAACGCCATGCCGGCG
ctctccttcagcgtcgggATCAGACACACAGGCACAACCATgagcgccatgaagatgatCCAGAAAATCTGACTGAACGAGTCCGggaacagcacgtcca
gcagagTGCTGCCCAGCACCAGGAAGGCGCACGGCACCAGCAGACACACGCCCATCTGAGAGACAaccgtgaagaagcggccCCACTTGCCCAGGGCCCA
CTCACCCAGGTCACCGTACGTCTTCACGGACGacggcgccaccagcatcaccttGGACAGCTTGAGCGTGGCGTAcgtgttggcgaagatcATGAAGGCA
AGGGCGATGGAAGCGAACACCGGACCGGCACGCGCGTAGTTGGAAGGCATGGCCAGTGAACCGATAccgcagacgcagcagaagaggttgaaggacgcct
tggcgtcctccatTGTGAAGAAGGCAGACTTGGCGTTCGAGGA