Description :
From Genome Similarity Track
Location :
Scaffold_746:359- 1716
Transcript NameFunction/comments
g15724.t1POM76437.1 Reverse transcriptase [Phytophthora palmivora var. palmivora

Sequence
1357 bases(100 bases per row)
ACGCTGGTAGAACCACTGAGCATAGCAATCATTGTATCGAACCTTCTTTACAGGCTTGGAAATGATTGACTGAGGGTTCTCAAGATGAACGAACGGTACA
TACAGACGAGAAGTAGTAAATGGCATGTAAGTACCATCGATGGTCGGTTCAAGTGCATTGACTACAGCACCCCAAGAAATGCTGAATGGAGCAGAAGCAG
CAAGAACACCAGCCATAGGATTACCGGTCGAAGAAGCTGAAACCATTACCGGACAGGTGTTGCCACTCGCGAGAGTAGTACTGGTTAGCGACATACCCTT
CGACGCATCTACAGCAACAGACGAAGTACCCTGGTTGACACGGAAACGGAGACGGATCTGAGGGTTAGCCATCAAGTCGAGCTCCTTGAAAACCGGATGG
AGGTCAGTTAGCTTAACCTTAAGCATATAGTTCCACGTTCCCATGATGGCGTTAACGGTAGCAGCACCAGCTACGAAGGCACCACGTGCAGTCTGATTCG
AGATAGTGGTAGACGCGGCAGCTCCACCTACCGACGGCCACGACGTAGAGAAATCAGAACCGGCATTAGGAGGGTTCGACAGAAGTCGGCGAACAAAGCC
ATCGTTAGGAATGGATGCACCACCCGAGGGGCCAGTGCTGGCAAACGAAGATGAGAATGCAGTATTGTTTGAGTATCCGTCTCCAGTAGTCGAGCTGGTA
CCAGAACTGTACAAAGCGGACTGAGCAGCATCCGGGTAAAGGAACGACTCTGCTCTATGCTTCTCAACGTACTGTGTGCTGTAGCTTGTCTGCGCGCGGA
CATTGTTCCAAAAGAGCTTGTAGTCAGCCATGGAAACAATGGTCTTACCATTTAGTTCAAGAGACATGCTATCAATGGCATTCCAGTTGCCACACTTTAG
AGTAGCACAGAAACGATTAGCAGCAGCAGTCTGAGCAGTAGCACCATTCATCATCGATACCTTGTATGGCAGCATGATGTACGCATCGCGAAGGCAAGAA
AATCCTTCGGAGCCGTTAAGCTGAGCAGTGGCATCGATAGTAATAACACCGTTCTGATACGACCCCTGGTTAAGATCGATTACAAACGGTACTCGCTTGC
CAGAAGATACCTTGATCTCCGGATCGCTCTTGAGCGAGCTCTGGTACAAATATTGGTCGGATAGTTGAGTTTCACTCATCGTTGATTGTATATGTTTTCT
AATATAGTTTGCACGAAATTAAATATTATGAGCAGCCTTATCAAGCCGATCACATCCGATCATGATCTAATCGAACTTGCAAAAAAAAATAGGTGTACAT
CTGGATGATATATATGAATCAAGTGAAATAACTAAGCCGCTCCCGAAGAAAGGCACA