Description :
From Genome Similarity Track
Location :
contig_36:358849- 360055
Transcript NameFunction/comments
g9219.t1hypothetical protein

Sequence
1206 bases(100 bases per row)
CTTGTCGTTTCCCGCTGCGTCTTGGTCGTTTTTCTCGTCATCCTTTCCTCCCGTGAGCACAACAGTGTGGTAGAAGCCCGCCGCAACCAAAGCCACTCGC
TTCCCCACGAAGTCATCAATGGGGAAGGGATAGAGCCGTTCATTCGTATCTCCAGTCCCCAGTTGACCATGATTGTTGCGACCGAAGACGTACATCACGC
CGTTGTCCGACACGGCGACCGTGTGGTAGCACCCACAAGCAAAGCGAACAATGTCCTTTCCTTCCAACTCCTCAATCAGTCTTGCGTACGAAAACCGCTG
CTGCTGAAGCTGGAGATTTGCAGCCAAACTTGCACCGGAGCGACCCAAACCAAGTTGTCCGTAGTCGTTTCGGCCAAACCCGAACAAATGCGCCCCACTG
CAAAGAGCAATAGTGTGATAGTATCCGCATCGAATCTCCAGACACTCTTGCTTCTCCAATCCAGCTCTAACCTGCACAGGAACCAGTTGGTTCTCCATGG
AGTCGACGCCAAGCTGGCCATAGTCATTTTTACCAAACGCGAACGCCTTGCCGGTGGCTGTCACTACCATCGTGTGGTACTGCCCACAAGCGACGGAAAC
TATGTGCTGATCGTTCAGCGCTTCGACGTGTTGTGGGACTTTGCGATCAATCGAGTCATTGTGGCCAAGCTGTCCGTAGTCGTTCCGTCCGAACGTGTAG
AGAAACTGCTGGCCACTCCCGTCTTCTTCGCAGGCCATGACAGTGTGGTAATAACTGCACGAGACCAGCCGTACGATCCTGTTTTCCAGACTCCGCACAA
CCTTGGGCACGCTCTCACTTGCAGTATTGCCATGGCCAAGCTGGCCACGATAGTTGTAGCCACAGGTTGCTGCTCGGCCCTCCATCGTAACCAGGATCGT
GTGCTCACATCCGTTGTAAGCGTGAACTTGCGAGATGCTGTTCTCCCCCAGCTTTGGAACTTCACTCAAGTGACTTACGCGAGCGGTTCCTCCTTGGCCA
CACTGACCGTTGTCGTTGTATCCACACGTGAGGACCTTCCCGTCGGCTGTCAAGGCAATGGTGTGCTCGTTTCCAGCGCCAATTTGCACAATCTCTTTCT
GCTGGAGTGACTCGATCCTTTCAAACGATTTACGAGACGCCGTGTCTCCGTGTCCGAGCTCCCCGTACGAGTTCTGGCCACAACTCCACGCTTCGCGGTC
TCCTTC