Description :
From Genome Similarity Track
Location :
contig_36:358842- 360048
Transcript NameFunction/comments
g8803.t1hypothetical protein

Sequence
1206 bases(100 bases per row)
CTTGTCGTTCCCCGCTGCGTCTTGGTCGTTTTTCTCGTCATCCTTTCCTCCCGTGAGCACAACAGTGTGGTAGAAGCCCGCCGCAACCAAAGCCACTCGC
TTCCCCACGAAGTCATCAATGGGGAAGGGATAGAGCCGTTCATTCGTATCTCCAGTCCCCAGTTGACCATGATTGTTGCGACCGAAGACGTACATCACGC
CGTTGTCCGACACGGCGACCGTGTGGTAGCACCCACAAGCAAAGCGAACAATGTCCTTTCCTTCCAACTCCTCAATCAGTCTTGCGTACGAAAACCGCTG
CTGCTGAAGCTGGAGATTTGCAGCCAAACTTGCACCGGAGCGACCCAAACCAAGTTGTCCGTAGTCGTTTCGGCCAAACCCGAACAAATGCGCCCCACTG
CAGAGAGCAATAGTGTGATAGTATCCGCATCGAATCTCCAGACACTCTTGCTTCTCCAATCCAGCTCTTACCTGCACAGGAACCAGTTGGTTCTCCATGG
AGTCGACGCCAAGCTGGCCATAGTCATTTTTACCAAACGCGAACGCCTTGCCGGTGGCTGTCACTACCATCGTGTGGTACTGCCCACAAGCGACGGAAAC
TATGTGCTGATCGTTCAGCGCTTCGACGTGTTGTGGGACTTTGCGATCAATCGAGTCATTGTGGCCAAGCTGTCCGTAGTCGTTCCGTCCGAACGTGTAG
AGAAACTGCTGGCCACTCCCGTCTTCTTCACAGGCCATGACAGTGTGGTAATAACTGCACGAGACCAGCCGTACGATCCTGTTTTCCAGACTCCGCACAA
CCTTGGGCACGCTCTCACTTGCAGTATTGCCATGGCCAAGCTGGCCACGATAGTTGTAGCCACAGGTTGCTGCTCGGCCCTCCATCGTAACCAGGATCGT
GTGCTCACATCCGTTGTAAGCGTGAACTTGCGAGATGCTGTTCTCCCCCAGCTTTGGAACTTCACTCAAGTGACTTACGCGAGCGGTTCCTCCTTGGCCA
CACTGACCGTTGTCGTTGTATCCACACGTGAGGACCTTCCCGTCGGCTGTCAAGGCAATGGTGTGCTCGTTTCCAGCGCCAATTTGCACAATCTCTTTCT
GCTGGAGTGACTCGATCCTTTCAAACGATTTACGAGACGCCGTGTCTCCGTGTCCGAGCTCCCCGTACGAGTTCTGGCCACAACTCCACGCTTCGCGGTC
TCCTTC