Description :
From Genome Similarity Track
Location :
Scaffold_179:35883- 38644
Transcript NameFunction/comments
Phyke_g7237hypothetical protein PHYSODRAFT_532111

Sequence
2761 bases(100 bases per row)
GTGGAGAATCACGAAGAGTTACCAGCAGATGTGGTGATCCTGGCCACTTCCGAGGAGGAAGGTCGGTGTTTTATCGAGACGTCGAATTTGGATGGTGAGA
CCAATCTCAAGCGCCGAATAGCAGTCAAGTCCACTGCACAAGCCATCGGTTGGCGTGAACTTCAAGGAGATTTTCTGCCACAAGAGACCGTTTGTGCTTC
AGCTGTGCGCAAGTTGCGCGGGTCTGTGGAACACGAACAGCCCAACAACCAATTGTATACCTTTACGGGGCGAATTCTGCTACGTGAGGGCGACCGAGGC
gagacagcaacaccactgGGCCCTGAAAATCTATTGCTCCGTGGATGCAGTCTCCGCAGTTGCGCGTACGTGGTTGGTCTCGTAATATTCACGGGTGGCG
AGACAAAGCTACTGCAAAActctcgagcagctccgtctAAGCAGAGCAAACTGTACCGAACCGCAAATAGCTGTATGTTGCTGATCTTCACCACCATGTT
TGCGCTTTGCTTGGCGAGCGCAATCGCTGCATCCTCTTGGAACAGTCGCAACGTCAATCGTGTGTGGTATTTGCCTTTCATCACGAAGCCGGATGGTGCC
AGCTTTATTGTGAATTTTTTCACGTTCCTCATCCTGTACAACAACCTCGTTCCCATTTCGCTCTACGTCTCCCTGGACATCATCAAAGTGCTGCAAGCCA
ACCGAATTACAGCGGACAGGAATATGGTGTACGAGGGCACCCGTGCTGTAGCGCGCACCTCAGAGTTAAACGAGGAGCTGGGACAGGTCGAGTACGTCTT
CAGCGACAAGACCGGCACTCTCACGTGCAACGTCATGGAATTCCGAAAGTGCTCCATTGGTGGCATTTCGTACGGTTTTGGCACTACAGAGATCGGTCGT
GCTGTGGCCGCCTTAGCTGGTGGAAACGCCGACCCGAATGGCTCTAGcacatcgtcgtcgccatctccagctAAAGCAAAAGTCAATCCAATGCTCGAAA
ACGCAGGAAGCGGTGGAAGCAGCGTACGACTCGATATCGTCTCGACGGATGATGTTCGCGAGCGTGTATCGCCAGCATTGCTACCCGAGATAGGCTCCCC
GAAAGAAGCTCAGGTGCACTTTGATCCGAACATTCATTTCGACGACCCAGGGCTGTTACGTGCGCTGTACGCTGGTGGCAAACAGGGCGAGCGCATTCAT
GAGTTTCTAATGCTTCTGTCAATTTGTCACACCGTGATCCCCGAGATCGACCCCAAGACGGGCTCCGTGGCCTATCGTGCGTCGTCGcctgacgaagaag
cactgGTGAAGGCTGCGAAGTGCCTTGGATATAACTTCGTGGCCCCGGCGCCGTTAATGAAAGTAGAAATTTCATGCAAGCCGTCTCTGCTTCCACCTGT
TACGGCAacggcgacggcgacgcaTGGTACTGTGTCGCTGGAACCCACCACCAAATCCTATACAATCTTGAACGTGAACGAGTTCAACTCGACTCGAAAG
CGAATGTCAGTGGTGGCAGTGAACGAGGAGACTCGTGAATACATTTTGTATTGCAAAGGTGCTGATAATATGATGCTGGAGCGTGCGACCACTAGCAAAA
ATGAAAGTGAGACAGAAGCTCGACTTAAACTTGAAAGTCATCTGAAGAATTATGCGCGTGAAGGGTTACGGACGCTGGTGCTTGGCCGACGAGTGCTTTC
CGAGGTAGAGTACAAGCAATACAACGATGCATACGTGGAGGCTTCCACGTCACTTGAAGACCGTGAAACGAAGCTGGACGCATGTGCTGAGATGATCGAG
AAGAATATGAACCTACTGGGAGTGACAGCCATCGAGGACAAACTACAGGAAGGTGTCCCCACTGCTATCTTTGATCTCGCTCAAGCAGGCATCAAGGTGT
GGGTACTGACAGGTGACCGTGAGGAGACAGCGATCAACATCGGACACGCGTGTCGGCTTATTAACGATAAAATGCAGTTGCTGTACGTGAATGCCGAGCG
TATCGACGCATTGAGTGCTCAGCTTGATGCCATGTACGAGACACCAGAACTGCAGCGACTGATGCGAGGCGGACAAGTAGCAGACAATTTGGCAATGGTG
TGTGACGGCAAGGCGCTGGTGCATGTGTTCCCCTCCCGCGATACCCGAATCAAGATGTCAGCTGAGGCAACTGCAAATGTCGATATGCTGGCGGAAAAGT
TGTTGGGCATTGCCAAAGTTTGCAAGGCCTTAATCGCTTGTCGCGTGAGTCCGTCGCAAAAAGCCGAGATTGTCCAGCTCGTTCGCAAAGGGGGCGTTAG
TGCAGACGGAAAAAAGAGGAAAGGTGCGCAGCCGATCACATTAGCCATCGGAGATGGTGCAAACGATGTGGGTATGATTCAGACGGCACATGTTGGTGTG
GGCATTTGCGGCAAAGAAGGAGTGCAGGCTGTGAACGCCAGCGACTACGCCGTGGCACAGTTCCGTTTCTTGACTCGGCTTGTGCTTCTGCATGGGCGAT
GCAACTACAAGCGCATTTGTAAAGTGATCCGCTACTCATTCTACAAGAACATCGCGCTCGTGATCAGTTTGTTCATGTTCAACTTTTTCAACGGCCAGTC
GGGTGCCCCGCTGTTTGAGAGCTTCGTGATGGCGGGGTGGAATTTTTTCCTGGCATTACCAATCATAGTGATCGGCGTCTACGACCAGGATATTCCAGAG
GACATCGTGTTGCGCTTTCCGCAGCTGTATCGCTGCGGCCAGCACGATAGCGACCTCAACA