Description :
From Genome Similarity Track
Location :
Scaffold_1694:3588- 5984
Transcript NameFunction/comments
Phyag_g11283conserved hypothetical protein
Phyag_g11284conserved hypothetical protein

Sequence
2396 bases(100 bases per row)
GCGAGTCAAGATGGCACGCGGAGGAGCAGTCGGACGACCGCGCAAGACGGATGGCGACCACACGCGCAAGCCCCGCAAGAAAAAAGACAAGAACGCCCCC
AAGCGCGCGCTGTCCGCCTTCATGTTCTTCAGCAACGACATCCGCGACacggtcaagaaggagatgccCGACCTGCAGTTCCTCGAGATCTCGAGCGAGA
TCGGACGCCGCTGGAAGCAGATCTCCGACGAGGAGCGCCGGGTGCGTTCTGCTGGTTAACTGTGTGACTGTCGCTTGTCTCTAACTGTTGTTTCCTTTGC
TCTTTTGTTCGTTGGTGTTACAGCCGTATGACGAGCTGGCCGCTGCCGACAAGAAGCGGTaccaggaggagaaggaagactACGTGCCCGACCCGTCGTT
GGAGTCATCCAAGGGTTcccgcaagaagaaagaccCGAACGCGCCCAAGCGCGCGCTGTCAgcctacttcttcttctgcaacgaCATCCGCCAGGAGGTG
CGCGATGAGAACccgaacaagaagatcacggagatcgccacgctgctggccgagaagTGGCGCGCGCTGcccgacaagaagcgcgccAAGTACCAAAAGA
TGCacgaggaggccaaggtCAAGTACCAGAAGGAGATGGACATCTACAACTCGACCGGCGGTGCCGTGGAGGAGcatgaggaggaggaacacgacgacga
cgacgatgatgacgaggaggacgacgaatAGGCTGTACAAAGTCTCTCACTCCACTCGTCTCGTTCGTcaggacgcagcagtgaAGACCAATGTCAGTTC
ACTAGCCAAGGAGTAGCATCGCCGCTCTTTCTTTTAGCTCGTAGTCAGCAGGACGCAAGGTATCCTCTTTTTATTCTTTCAAAGCTTTTGGTAACGTTCG
TGCGTTTTTCCATTTCAATGAGATTGCCGTGTTTCTTGCTAGTcgcgcttcaacttgtcgtGTGCTTGCGTTATGGTGACTTGATCATTTGTTCGTCCAC
ACGGTCAATCAACAAACGCAAACACGCTGATCAGCGCTACGACATGTCGCGGCGGGctcatggcggtggtgcctTCAAAGCATGTACCGCCCGAGCTGAG
CAAACAAATGGCTACGTAGTTCGTGCATGTCTTCTATTGATGTAAAATGCGGCAACCTGTGCCGCTGCGGACCGACctaatgcagcagcacctcgaagTC
GGGAGtcacgacgagatggcgcTCCACGTTGCCCAGGATACTCAGATGCTTCTCGGTTGTGTTGACGGCGTAGACCTCCTCGCAGAACGACGGCGTCTgg
gccgccgccacctcgaACTGTTTGTCGCCGAGCATCAGCACCATCTTGCCCGACTTGTGCACGCAAATCTGACGACGACACAAGGAGTAGCAGTGTTAAA
TCTCGGCTCAACAGCAAAAACCTAGCTATATCTTTCTTACCTTGCCAACAAACCCGCCCGGCGCCGTCTCGATAGAGTGGTCATACACGCCATCATCCCT
ATCATTTCAAACAAAGAAACAGTCAGAATCACCTAATagaccgccgccaccaacagccAAGTGTCCACCACGTACGGTGACTCGTCCGAGTTTTTGTTCT
CCTTCGACTCGTCTGCACTTTCCATCGACTCATCATCATCCGTACtcgccgccaccttggccACAGCACTCGACAGCGGCAATGTCGTCGGCatctggat
gaagaagagggagTCGTCGGACGCCACCAGGTCGCCCGTAGCGTCGCAGAAcactgctccagcactttCCGGCTCCGGCGGCCTCACGACCGGCAGACTC
ATCGGCTCCATCACGGACTTGACAACGGGAGGCCAcacttcttccacctccatctcTGGCACTTTCCCTCCtggcatctcgtcgtcgtccagcacactGA
TTCCTGTACCACCAGCAGCCGAATAGTCGGCCGACGGAGTGGCTCGTGGAGCAGGCGCATTGCCTGCTCCACTGTACGAAGATCCACCCGAGAGGGTACC
AACAAATGCAACCTTCCCGCTCGGTAACACACCAcggccacgaccacgacctcGTCCGCCGCCACGTCCTCCCCTGCCTCCACGACCGCTGCGCCCTCTG
TTGTCGTGTTTGAGGGCCCCAACGCCAGTTGAGTGCGGCTTAGCATCGTTCGAGCGCTGTGGTCCGGTGGAAGATCCTTCTCCGCGCGATTCCGATACTG
GACGACGCTTTGCAGCCTTTGGAACGAACTTGGGGCGTCGTGCAGGGGCAGCAGATGCATCGGTCGACGTGCGGAGGGACCTGAgggtggaagaagagga
gtTGGAAAAAACTACAAGAGGTCATGGGGAGGTGGACGTACGTGAGGCGcgcgctggacgcgtcgaCGCGAGGACGCACGGAGCCGTCTCCGCTGG