Description :
From Genome Similarity Track
Location :
Scaffold_1387:3588- 5046
Transcript NameFunction/comments

Sequence
1458 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTGTATACGTCCGCTGGTGTGCTTAGCCATTTTCCCGCCAAATTACAGCGAGTTG
CTTGGAGTGCTCTCGAGAAATCCTGAAGTCCTAATCCTCCTGCTGATTTGGGCGTGAAGAGTAAAGCTGCGTTGATTTTGTGAGTGCTGGATTCTGTGCT
CGCGGATGCTCTCCATAGAAATTGTTTCTGTATGTTTTCGAGTTGTCTAAGTGTTGCTATGGGTGGGATGAATTGCTTGCCCGTGTAGAGAATTGCCGGT
AGTGCGATCACGTTGATTAGCATGATCCTCTGTGCCACAGAGTTCCCCTACTGTGGTCGCTATCCTGAGGCGTCGTTGTATCTTTTCAATCCGGATGTTC
CAGTTCTCTGTCGTTGCTTCTTTGTTGCCTACCCAGTATCCCAGCTGCCGCGTCGTCTCTCCCGGCTGTAAAACGGGGTATTCTTGCCACTTGGTTGGCG
TTCTTGCACTGTTGAGTCCGATGAGTATGCATTTTTCCGGTTGTATCTGTAGTCCTGAGAGTTCACCAAATGTTCGTAGTGTCCGTTGTACTGCTGGTAG
TTCTTTTAGCGAGTTCATGTACACTGTGCTGTCGTCCACGAAGGCTGAGAACTTGTGTCTGAACTTTGAGTTCCCTGGTATTGCGATGCCGGTGATTTCG
GGTTGCTGGTCAATTGCGTGGCTGAGAATTTCGACTGCCAGAATGAATAGTAATGGCGCTAACGGGCACCCTTGACGTATTCCTGACCCTACTGTCCATT
TGGTTGAAGTTTTGCCATTTACAAGAAATCGAGCTGTGGTTCCGTTGTATAGCCGAGATAATTTTTTCCGAAAAGCCAAATTTATTGAGTACCATGAGAA
TGAATGTTCTGTCAAGGGTGTCATAGGCTTTTCTCAAATCCAGACACAGGACTGCTGATAAATCTGACCATGCTTTGACTGGGTCATGAACACTTGCTGT
TAATATGGTTCGTAATATCGTGACAGTTTTGTCAATGTTCCTTCCTCTGACAAAGTCTTGTTGTGCTGGGTTAATGAGTGTTGGGAGAAATTGGTGGAGT
CGATCTGCTAGAATTCGTCCGAAAAGTTTATATGCTGTGTTTAGCAAGGCAATAGGTC