Description :
From Genome Similarity Track
Location :
Scaffold_310:35878- 38518
Transcript NameFunction/comments
Phyci_256730unnamed protein product

Sequence
2640 bases(100 bases per row)
CGCGCGCACCGCAATTCCGTGCCAAGAACAGCGTGCTGCCGAAGAGCGAGCCCGCCGTGATCGAGCAGTCCGCGATGGGGCCCGTGACCACCACGGGGTG
CAGTGAATGCCGCAGCGTGTAGAAGGCAAAGCCACCCTGACGGCCCTTAAGTGATGCAAAGGAGTGCGTCGGCGGTAGGGCCTCCACCCGCACAGAGATC
TTGCCAGAGATCGCGTCGATGTACGTCATCTGGCGCAGGCGCAGTGCCTGCTTCGGGTCAGCCGCCGCCTTGGCGATCTGCTGCTTCAATGGCTCGCTCG
CCTTCACCAGGTGCTCTAGCAAGAAGTCATAGCTCCAGGCGCCAACCTCGTCCTGGCTGCCCGCCACCGTAGCGCTCGCCTCCCACGGGCTCTCGATGTC
GGCGTCCTTCATATCAATGTCGAAGCCCATCTCACGCGCGATCATGATGGCCTTCTTGGCACTACGCACGCCCATGACATCGTCCACGATGTCGCGCACG
CTGAACTCGTTCTTGTACTCCTCCATGAGATCCTTCATGATGGCTCCCAGATCAGCATTGGCAGGCTCAGGCAGAGCGAACACGGCGTCGAAGACGGCGT
GCAGGAAGCGGCTGCCCGAGTACTCTACCCGCTGAATATCGTCACCGGTCTGGATGAAGTTCTGGATCGTGTTGAAAATGGGCACACCGATGGCAAGCGT
AGCCTCAGGGTCGTACGTGAGCTCGTTCTCGATCGCCAACTGCTGCATAGCGTTATGCTGCTCCGTCGAGGCCGACGAGACGTTGATGTTGGACGTCATG
ACGTGCACCTTGCGGGCTAGCCACTGAGGGTACAGGTCCTTCACGTGGTGCGAGCTGTTGGAAACATCGATGATGAGCCAGTGCGGAAGGTGGTCGGCGC
ACACGTGGTCGAGGAACTGATTCCTGTCGAAAGGCACGAACTCGTCCTTACGCGCCGCCAGGGCCTCCTCCGTAATGTCGCCTTCGAAGTCGAGCAGCAT
CTTCGACGTGATGTGAGTGCCGATAGCGCGCACACGAATGTCAACGTTGAAACGCTGCTTGAGAAACTCGCGCTGCTGGTGGTATTGCTTAAGCAGAGCA
ACACCAATGCTGTTAGTCTCGTCCTCACCGAACTCAAGGCCCATCAGACCGATGGAAAGAGTCTGGTCCGATAGGAAGAACGACGAGTGCACGGCGCGCA
GTGCAGCGGCCGAGTCCTCGTAGCGCACCACAGCCGAAATGTTGCGCTCCGACGATCCCTGAGAGATGGCGAGCACGTTAATCTTGGCACGGCCCAGAGC
GCCGAAGAAGCGGGCGCACACGCCAGGGGTCTGGTTCATTTGATCGCCGACAGCAGCAATGATACTGATCGGCGCGATGTACTCGGCCTTGTCGATGTGC
CCGACGTGGATCTCCTTGAAGAACGTCTCGTTAATCACGTCCTTGGCGATCTCGGCACAGTCCATAGGCACAGCGAAACAGATCGAGTGCTCCGAGCTGG
CCTGGGCAATGAGGACAACGTTCACCTTGACGCGGTCCAGCGCGCTGAATAGCCGTGACGACGTGCCGTGCACGCCGACCATGCCGCTGCCTTCGATGTT
GAACAGCGCGAGGTCGTCCACAGTGGAGAAGCCGCTCACGATGTTGCGCGCCGTGGGGGCGCCGTTCGACAAGGTGCGCTTAAGCTCCACCTTCTTGCGG
TGCGAAATCTTCGTGCCTGGGTGCTCCGGCTCAAACGTATTCCGAATGTAGATAGGAATATCCTCCACGATAGCAGGCGCCATGGTCTTCGGGTGGATCA
CCTTCGCACCGAAGTACGCCAGCTCCATAGCCTCCTGGTACGAGATCTCGGGTAGAATCTGCGACTCGGGCACGCGGCGCGGGTCGGCGCTCAGCACACC
ACTCACATCTGTCCAAATCGTCACGCTGCTGGCATGCAGCACGCGGCCACAGATGGAGGCAGTGAAGTCACTGCCGTCGCGCTTGAGCGTGGTCATGACG
CCCTCGGTCGTGCTGCAGATGAAGCCCGTGACGACCAAGTGCGTGAGCTCGCCGTCCTCTCCGCTCTTGAGGATATCCTGCATCTTCTGCGTGGACAGGT
CGTACTGCACCACCGGTCCGTGCTCGTTGTCCGGCTCGACCGTGAGGAAATCACGGGCGTCCACGAAGCGGAAGTGGTGCTTCTTGCCGTCGCTCTGCAC
TCTCTGGCTCAGCACGGCCGTGAGGATCTTGGCCGACCAGATCTCGCCGTGGCCGGAGATGAACTCCACCACGTTGTCGTTGTAGGCCTGCATGATGGAG
ATGGAGCGCAGCAGCTCCGAGACGGACTGCAGGTCGCGCTCGATGGCCTTCTCGATGGGCTCGCCCACCTCGGGCGGCAGCAGCGTGCTCACCACGTCGT
GGTGCTTCTTGCGCAGCGTGGCCAGGATGTCCTCGCACTCTGCCGTGCGCCGCTGCTTGGCCAGCTCCAGCAGCGAGATGAGCAGGTCCGTGACCTTGGG
CTTGCCACCGATAGCTGACACCACCACGGCCACGCGCGGGGCCTCCAGCGCCGACACGATGTCCGCCACCTTGGCGAAGCAGTCGGCGCTGCCCACGGAC
GTGCCGCCGAACTTGTGCACCACGAACTTGTCTGCCATCG