Description :
From Genome Similarity Track
Location :
Scaffold_220:35878- 38368
Transcript NameFunction/comments
Phyta_totarag5797hypothetical protein

Sequence
2490 bases(100 bases per row)
AGTGAACCAGTGATGAATTTTCCAGCCAAAAAAAGTTAatccacagcaccaacactgcgtttctgcttctttcAATGCGACTGTTCTGTTGAGAAACCCC
CAGTATCTGACTTCACTCGGTTTACTCTAAAGTTGCGTATGTGCATGTGTGTCTATCATCCAGATGAGGCAGAAATAATGACGAATTTGTACCTTTGGGT
TTTCGACGTTTACCCAAGAGCAGTACCAACTACTTCGTGTCATGTTGGGTAGTTCTGTTGAAACGGTTGGCTGATCTACCTCAAACAAGTCTTTATGTAT
TGCTACAATATGCTGCTTTGTGGATTCGACTTGGCCTGGTAGAGGCTACCGCGAGGAAAATGTGCCCAAGGAAGCCCTCTTGGCAAGTTGACCTTGATGA
ATTCTCGGCAGCAAGCTGAAAAAGTTCCAATTGTCTAGGACGCACGTGATCCCACTCGTACCGGCCTCGGCGCGCACAACGTGTACTCCTTGCAGGTGCC
GGGCACACAAGTCGTAAACTTCCAGCAATGAATCTTCCGTGCTCTTTTCCTCGCTGGTCGCTTCTGCAACgttgctaccggtagttggCTGGCTCGGTTC
ATGCTGAATATGGCTGTGGTGTGCTGCAAGCTTTGTCGTCTCGGATAACCTCGCTGTTTGCGGGTTTTTGGTTGCAGCAGTAGATAAAGACGAAACGGTA
AACTCTGTCGAAGACCCATTTGGTCGTGACGCTGGATGAGCACCAGCCACAGCGTAGCTCGTCTCAGAAAACTCAGCACGCAGCGAGTCTCCTTTGGCTT
TCCATTCCTTGGCCAGCCCACCTGGAGTCTCTAACACGTGCGTAAGCAGCGCAAACCAATGTGGTGAGAGGACACTTCGAACCCATTGATTCTCTTGAAG
CACAGCTCTCAGGTTGGTAAACGACCATGTCGCGCTCAGCTGTTGCGAGTGCTGAAGTGCATGAGCAACACGGCGAAGTGTCTTGATTAGTAAATGCTGG
CGGCTCTCGGTTTTATTGTCACCACCAGTCGAATGTTGTGGAATTTCATCTTGTTGATTGTCGCCGGATCGAGTTGATGTCGACTGGCGTCGTTGGTTTG
GCACCACTGACTTCCTTTTCGTCTGCTCACGCTCTCTTTCCATTTGTGCAATGTACGCTGCGTCCTCGCGTTCATGGGCCAGATCAGCACTGAGTTGCTG
GGCAGCCTGGGAGAAGATTTGAGCCCATGCCTGGCGGTTCAGCCGCAAGTCCATTTGAGTGCGGCAGGACCATTGAGCGCCAAGGTTGAGGTTCCTCGCT
ACCAGTAGATCCTCCAGTGAGTGACCGCACAACCAGCGTAGAGAAAATCTCTGAATAAGGTGGTCAAACTGCATGGACGACGGCAAACCGAGAGTCTGCA
TCACATGGTACAAGTCCAATTTGCCTGTAAACAAGATCACTAAACGAATTACCACAGATGGCGTCACAGCTCCGTTACTTGTTGGCCCCATTCGTAGTTG
GGCTTTTGTCGGCAGCGTGATAAACCACCGGTGGAAAAACGGCAACGACTCGATATGGTCACCAAAAAATTCCCCAATAAACCAAGTTAGTCGGTCAACC
AGGACGTGAGCATCACTTTCTGCCAAAGGAAGGTACACAACTTGTTAGACTTATTCGATAAACCTGCACTAGCAAAGCACAAACCTTTCGTGCCACTCCG
ACAGGTCAGATCAATGTATAGGAAACACTCAGCACCGCGCTCCAGATATTTCAGCTCATGAAGCGTGGCGGCAGCTTCAGTAGAACACAACGTGACTCAA
GTTACGTTTTTGATTGTTTTGGTCTGAGTAGAAGCTGTACTTACAATCGGCATCCGAGTTGTACGCGAGATGAACGGTGGCAGCTGTAGAAAACCTGGGT
CCAATATCAACTTTTAGCATGTAATCGCCACGGTCACCCCCAGGTGTACGAGATTGTAGGCAGCTTGATGACAGAAGCCCCGTGGATGATATTTGCCGCA
CACAGGCGAGAGCCCAACGAGCTCGCCGCTTGAGGTGTCTCAAGGCACAGAAGGACTGCAATCGGCACTGCAAAAAGAATCTACGCCAGCGCTTAATCAG
TACCACAGTCACAAACGAAAAATAATCAGTAACATAGGCCTATGCCATAACATCAGACATCCACTTACTGTCTGGACAGCTGGATACCATGACGAAAAAA
CGAGACTCAGCAGCCCAACCTTGCAGATTCGAGGCTGCTCTTCGGTGTGTCCGCTTCTAGTAAAACTTTCATTCGTATAGCGCAGTGCAGATTTCTGTCG
GTATCCGAATAGACGCAACGTGCGCTTCAATTGATGTATAAAGCGCTGACATCGCGCAAATTGGTATCTCCTTTCAATAATCTCCGTCGTCTCTTCACCC
GTCAGCACGAATCCAATCTCCGCCAACAGATACTGCGCCGCTTTAGCAGTAACAGTACCCGTTGGGTCATCCATATACTCATCAAAAAGC