Description :
From Genome Similarity Track
Location :
Scaffold_514:35876- 40034
Sequence
4158 bases(100 bases per row)
TTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCATGGATCCAACCTCCATTGCTTGGATCT
CAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGTCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAG
AGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCC
TTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGA
TTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGTTCGAT
CCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTC
CCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAAT
ACACCAAACAACCTGCTAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATC
CACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCC
CCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATC
CACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACC
ACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCCTGGCAACTGACACTTCA
TGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGG
CTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGG
ATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCT
TGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAG
ATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAG
ACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCG
TAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCTCGATCCACCGCTCGCAGTACTTCTTCAAGCTC
GTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGAT
CCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGT
ATTGTCGTGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATA
CCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATC
CATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTG
CCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTC
CATCTCCACGTCCCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCA
AAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGAACTGGATCCGTGAGGCGATTACCTCGAGCCTGAT
CTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTT
CACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCAAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGAC
TCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGGTCCATAGTGCGCGACCTTTCTCCGGTGATGGACT
TAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTC
CGTAAGCAGACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTC
AGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCCTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAG
CTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAG
GTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCA
GGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCC
ATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTG
GGACTCACGGTGAAATCCCTGGTTCGAATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAA
CTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTC
TCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCC
GTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTAGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGC
CTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG