Description :
From Genome Similarity Track
Location :
Scaffold_42:358741- 366300
Sequence
7559 bases(100 bases per row)
CCAACTTGGATTTGATATGGACGGGTGGCTTCGTTGTGTCGATCCGCTCGATCTGGTATCGCACTCCGTCGCCGTTCGCTCACTTGGGATCTGGCTTGCC
CGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTAGATACCGGAACTGGCCCGCTTCTAGGGTTGATTTAGAA
TCTCCACCCATGTACCAAGTAAAAATGGGGTATCACCCCGGATCCTGTCATGGGCGGTGTTCATCGCGAAGGGGAGTCGTTCTGCGTACACATCCCAATC
CTTCTGACCCAAATCCTGGACATACATCTAGAGTACCCTCGTGATCGTCTGTACCATGCGCTCGGCCGATCCGTTATCTTGGGGACGATCTGCCATGATT
GGCCGCTGTCTCTGTCCCAGGGTCCGGTTGAAAGCTCGAAATGATCAGACATAAAGCCTGGCTCCCAATCATGTCTAATCATCTCACTAGCCCCACATCT
TCGGAAAACGCACTTCTCGTACGATTCGTCAATGGTTTGCGCAGTTCTAGACGCACTCGCTTTGGCTACCACGTATCCGGTAAACAGATCTACCCAAATC
AACAATTCTGTGTTTCCTTTAAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACT
CCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCACCGACATACCGTTGCACGCTCTTGATTAGTCCCCTCCAGTGGAAACATTC
TCGGATCCGTTGGTAGGCCCGACCAATTCCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGACATAAGGTTTCTGGCATCACCAGCCTCAT
CAATCCATCCCGATCTTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCAACCATACTGTAGGAT
TTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTTAA
TGCGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCTGGACTATCCTTTTCCC
GGATCCAACTACCACCACTTCGACTAGTCGGTTTAGTGTGACAAGATCCTGACGCTCGGCCTCTTTCTCCACCTCAACCCCACATTGATTCCGTAAAGCG
GCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGTACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTA
ACAGTGTTAGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCACAAATCCCCAGCCTTTTCGGATCCTGTCCC
TTTAGTATATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCCTGCGCATAAGTGGGTCTGGCCCGTACAACTTCGCATCCGG
GCAGTCGCCACAGTATTGCGCTGTATGCCCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACCTGTACCGT
CGGGATCGGGATCTGGATCAGGCGTTTGGGCTCTTTCTAAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAA
ACGCCCAGGATCTCGTCTTCCCCTTTCGAATTTTTCACAATCTCCTGTGTCCAAGGCGAGCGTAAAGCTGCCCACTGTCCCAATCGTCCTTGTAAACCGG
CCGACTTGAACAACCAAGCTAGCGTAGAGTGTCAAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGC
GAGTATCGCCTTCTCCACCGCTCCGTAGTTCAGTTCATTTGGCTTTAGCGTTCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACC
AAGGCTGCGGAGACTGCCCAGTCACTAGCATAGACTATCACCGTAGGCTGACATTCCGGATCGAAATGGCGGAGGATGGGCGTCGTCGCGATCCTGTTCC
TTAGCTCCACGAACGCGTGCTGAGCTCGGATCCACCGAGGCTCCACCTTTTCCAAACGCTTCCCTGTTGTCTCTTCCAGATTGGATCCTCTTTCTTTTGG
TCCCGGGGCAGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTATTACTTGGATCCCTTCGTGTATCCGACATCTCCAGGGTCAGAGCCTGTTGGA
TTTTGATCCGGACAGCCGAAGTGGCCATCGCAGCAAAATCCACCTCCCTCAGTTCATAGAGTACTGCAGCAAAAAGTGCGTAATCCTCGATTAACCGACT
GTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTATCGACTGTGGGAAGGACAAGTCTGCAGTTGCTCGGTCGAGATCAGAGCCGCGTTCATCG
CGAGCTCTACTTCTCGGACCCAGAACCATGTACTGTATTGTCAATTCCGCGATATAAACTCCAAGTAATTAGAGAATTGGGGACCGGCTTCGAAATAGGC
TAGAGCTCACAAAGCCTACTACGTATCGGATAGTACTTACGGTGCGGTTTTAACCCATTCTGCAATTCATGCTTAGAAATAGCAACTTGCTATTATTTAA
TAGCCACTCTATTGGGTATTAAAAAAATACTATTGGAATATTGGGAGCAATAATAATATTAGTACATGAAGCTCATATAACGTGCAAATCTGTCTGCTAT
TTTGGGAGAGTTTTTGACATTGCTTCCTGCGTGCGTGACGAGTGCCTCCACCGCCGGCGGCGCCGAGAGTATCGGCGAGAGGCAACTTGCCTCAGGCAAG
CAGTCGAGGGCATCTTGCAGCTGCAGGAAGGCCAAACGACAGAGAATTTCTGGGCGCTCCAGGTGCTGCAAGTTGCAGCCTGCAACGAGAGTTTCACTGT
GAGACACCGTGTCTGATCGAGAAGCAATTTATACCGCTGCGCCGCACGGTGTCGTCACAGCAGACCTCCTATGATTGGACCTATCTGCGCTGGCATCGCA
AACAGCATCGACTCGCAATTTATCGGTTATCGTTGCTGCTGGCCCTGCATGGTTCCTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCACTTGTTCCTGGTGGATCTGCC
GCTGCCGATACCAGTTCCTGACTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACATTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGAC
CTTGCTGATCCATATTCTCGCTCGGTCCTCGTCTTGATCCTTGCCCGTGAACTCCATCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGAC
GATCCACCTGCAGTTGTTGCTACCACCGCTGACGACGGGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGTAGTTGTCTCCCTCCACTGACT
CCATCTCCACGTCTCGTGCCCCATGTTCGTGGAACACTTGCGCGGTGCGGCTTGGGCACCCTCATGCCTTGTTCGGCCAGGACATTGCAGCTTCGAAATA
TCGTTGCAGGGTGTCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGAATCCATGAGGCGATTACCTTGGACCTGATCTGAC
GATAATCCCACTGGCTTCTTGCTGGATCTGGCTCGATCTTGGTTGGATGGTGTCAGATCGTGAGCATGGCGTACGGGATCCCAAGTCTTCACACTCAAGG
GTGCTTCCTGTTCCCGGAACCGCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTTCCAAAGTCATGCGTCGGGGCTCGAACGACGTGTCTGACCCATC
CTCAGCCGCGGATTCGTAGTTCGAGGACGCAGCTTGGATGATCCTCGGCGACGACACTGGATCCATAGTGTGCGACCTTTCTCCGGTGATGGGACTTGAC
TCTGACGAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATATCTTCTGCGTCGAGCACACCAGCTACGATGCCTGACTCCGTA
AGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGA
TCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACACGAGATCCTTGTCGGACCAACTTGAACTGGATCCAGCTTG
GTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACCAGCGGGGTTAAGTTTAGGTAC
AGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGGTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGG
TCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCG
ATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTACGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGAC
TCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGGGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATCGCCGGATCCAGCTTACCA
ACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGGTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGAAATCTTGC
TCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGT
CCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTT
GCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTG