Description :
From Genome Similarity Track
Location :
Scaffold_39:358721- 364600
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011952Similar to ypgQ: Uncharacterized protein ypgQ (Bacillus subtilis)
Pytul_DAOMBR144PYU1_G011951Similar to ZBP14: 14 kDa zinc-binding protein (Zea mays)
Pytul_DAOMBR144PYU1_G011950Protein of unknown function
Pytul_DAOMBR144PYU1_G011949Similar to cluA: Protein KIAA0664 homolog (Dictyostelium discoideum)

Sequence
5879 bases(100 bases per row)
TCATATGGGGATGTCTATAGAAACTTTTCAAGCTTTGCGGGATGATGAAGACGAACGCAGGGAAGCGCATCGCCGAAGAGCGTCACGCGTTCATGGAAGT
GTTTGTGGCTCAGTTCTACAAAGAGATCAGCGGCCGTGGATAGAAAAAGACAAAAAACAAAAAAACAGCGTCGCTACTTGGACTTTAATAAGAGATAACA
CATTGCTTCGAATACATAGAGAAAACGGCACTGAACGTGTATTTAGTACGCTCAATTGGTGATGACAATGAATCTTGTGGAGTCGCGTGCAAGCTAACTG
CATTGCAAACTGCTCAACCTGGTGGCCAGCCGAGCTTGCGTCCGCCAAGCAAGTGAAGGTGCAAGTGGAACACGGACTGGCAGCCGTCCTGTCCGTCGTT
GATCACGATGCGGAAGCCGTTGTCCAGCTGCTGCTGCTTGGCAATCACCTTGGCCGTGTGCAGCAAGTGGCCCAAGACGCCTTCGTGGCGCTCCTCGGCG
TGCACGAGCTGCGTGAGTCCGTCGCGGACCTTCGGGATGATCAGGATGTGCACGGGCGCCTGCGGGTTCACGTCGTGGAACGCGAGCACCTGGTCGTCTT
CGAACACGATCTTGGCGGGGATCTCGCGCTTGATGATCTTGTCGAAGATCGTCTCGCCGACGTGCGCCGCGGTGCCGGCGGCCGCAGCGGCGTCCGAGCG
CGCGCGTTCGTCGCTGGAGGAGGAGGAGCTCATGGCGCGCTCGTGGAAGCGCAGCTGCGACGTCGCGCGCGAGTGCGGAAGCGTGACGAGAGCGTGGGTG
GAGCGGCGGCGAAGAGCTCTGACGAGCATTGATACTGTGACTGTGAATGGGGGATTCATTCCCAGTGTGCCGTTGGGTTCACCTTCGCGTCACATTATGG
TTGTCGTTTATACGCTGCGCGTCACAGCGTATATGCTGTTCGAGAGGTTTGTTTTTCTGCTGGTGCTCTGTTTGTGTCCTTTTGAGGCTGTAGGGGGTAC
GGGGTCGGGGTCGTGTTTATGGTTCGAAACTTTTCTTATGGCAGAGCCGTTTTACCCAACAAAACCCACTAAAACGAAGCACACGATACCCTATGAACAA
AGCAAATAGCCTACATGCACAAGCAGCAGCGACGGTTTGCAACGGGATTGACGAGACTCTCTAGGAAGGGCGCTGTGAGCATGCAAAATGCATAGACTGC
ACTAGGATATAACTTATGAAGAAGGCTGTAGTGTTGTGTTTGCGTTCTTCGTGGTTTGTGCGCAGTTTAAGCTCGGCAAAGAGACTTCAACAGCAACCCT
TGCAAGTCAATAGCCTTCCAAACAGCATACAAGCCGCCGTTGCATCCTTGACCGTAGTATCTATTTCTAGAGGTTAGTTATGGTTATCATCATCCGGTGC
GCAACGCGCCACCATTCGCTCATTGGCAGGCTAGTCTTTGGCTATCCGACCAGCACGTATTTCACATACATTTTCTATTACAACCCATCTCGAAACTTCC
GTTCCTCAAGTTCTACGTACTAGTCCGCGAGCCGCCTCCCGTGGCAACTCCAATCTTTGCGCCACAACCACAAAGCGCCATCTCTCTCATTTGCGCGCTT
TCCGTATCCTGCAGTAGCAAATTGAACGAACATGGGCAAAGCCAAGAGCGACGCGCCCGCGCAGCAAGAGCCCGTGGTAGCGGCACAACATCCCAACGCC
GAGGAAGAGGCAGTCGAGGAGCCGATGTTCACGCTCTTCGTGGAGCCGCCAACGACCGCTGGAGGCAAAGATGCGCCGCTCGTGCGTCTCGACAGCGTGA
GCGCGGGCGACACGGTACTCTCGCTGCGCCAGTTGATCGCCGAGTACCCAGCGCTCGCGGGCTACACATGCTACCACCTCGAGGTGTACTCGGTCGCGCA
CAGGAAGTGGTTCGTAACATTTGCATGATGTCGTGCATGCGCCGCATACAAGTAAATTTTGTTTGTTTGTAACATGCTGGATGTATGTATGCGTGTATAA
TGTGCATTGCACAGGGTGGTGTTGAATGACTTTGTGGAGCTCGGCGAGTACGAGGACATCGTGGATCGCGCGACGCTCAAGATGGTGCTGGAAAAGTACG
ACGCGCGCAAGGTGCGCGCGCACGTGCGCCGCTTCCGCGACGTGCTGAGTAACCCGCCGATCCCGCAGCTCGCGGGCGACGATGAGGACGACGGTGGCGC
CGCCATCACGCCGCGCACGCCACGCACGCCATCTGCTGCGGCCACGCCGAGCGGCAGCAAGTCGAGCAGGAGCAAGCGCAACAAGAACAAACAGCAGCAG
CAGCAACAGCAGCAGCAGGTGACGGAAGTTGCAAACGGCGCGAGCGACGCTGCTGCTGCGGAGGCCGCCAGCAAAAGCGAGATCTCGGAGACGCAGCTGC
AGCAGCTGCGTGACATCCACGCCAAGCTCGAGACCGTCACGGTGCCCGTGCTCCCGGAGCTCGAGGAGTTCTACTCGCTCCCGGGCGCCAGCAGCAGCAA
CGACAAGGAGACGAACAACAACAGCAACAACAGCACGCCTGGTGGCAAGAAGGGCAAGAAGAAGAACGGCGACAAGAACAAGCAAGCCAAGCAACAGGAG
CCAGACGCGACCGTCAGCGGCAATCCGCTGGACGCCACGCTGCCGATATGCGTCAAGAGCATCGTGTTCTCGGGCTACAACCCGCCGCCAGGGCCTCGCA
AGCTCGCGGGTGACCTACTGTACCTTGAGGTGAAGATCGCCGACGGCGCCGTGTTCCACGTGACGGCGCACGTCAACGGCTTCTACGTCAACCGTTCCAC
GACTGCGCACTTCGACCCGGCGCCGCACGCCAACTCGCAGCAAGCGCATCTGCTCGTGGACGTGCTTTCAAACGCGTCCGAGGCGTTCAAGAACGCGTAC
GCGGCGCTGCTGGCCAAGGCCGCGGTGCTCGCCAAGCAAGGCCCAGCGTCCATCGAGTGGATGGTCGCGGCCGGCAACAACGTCGGCGGCAAGCTGCCGT
GGAACACGCCACTGGCGCAGAATGCGCCGAAGCACACGTACGATCTGAACCGCGCTGAGGACGAACTCACAGCGTCCTTCGGCATGGACGAGCGCGGTGT
GCTCCGCGACTGGAACGAGGAGTACCAGTGCTGCCGCGAACTGCCGCACGCGACCGTCAAGGAGCAGGTCGTGCGCGCGCGCGTGATGTACAAGATCGTG
AACGAGTTTGTGGAAGCCGCGACGCAGGGCGCCGTGGCCATCGTGGAGGGCCACATCCCACCGATCAACCCGATGGACGATGCGAGCGCGCACGTGTACG
TGTTCAACAACATCTTCTTCTCACTTTCCATCGACGGCAAGGTCACGCCTAAGGACGTCGCGGGCGGTCTGGGCGACGGCGAGGAAGCCGCGTACTCGTC
GGCGAACCGCGACTTGCAGGGCGTCAAGGCGTTCAACGAGGCGGACATCCCGGGCCTCCACACGCTCGCGACAACGGTCGTGGACTACTTGGGCGTGCGC
GTGATCGCGCAGTCGGTGATCCCTGGCATCCTGCAGGGCGAGGCCGCGTCCAAGCTCGTGTACGGCTCCGTGGACGGCGGCAAGACGATCGCGTCGAACG
ACAAGATGCACGCGCTCATGATCCAGGCCGGCGAGAAGCTCCACATTGCTGAGCGCAGCATCCAGCCGCTTGGCAAGGACGAGAGCGAGGAAGCGGTGAC
TGAAGAAGACGCTGAGGCTGCGAGCGTTGGCGGTGAAGCCGGCACGGAGGTCGTGAAGCTCTGTGGCCCTGTGGAAGCCAAGGGCATCTTGGGCTCGGAT
GGCCGCATGTACGTGTTGGATCTTGTGCGCATCACGCCGAAGGACGCGACGTACTACGCCAACAGCAAGGAGCAGAAGCCAGAAGAGGGCGTTGTCGAGG
ACAAGGAGGGACTGCGCTTCCACCGCGAGGACGAAGGCTACGTCGCGCTGCTGCGTCCTGAACTCGTGCAGTTGTACGCGCTCTGGAAGCAGAACCAGGC
GCGCAAGGAAGCGCGTGAGGCGCTGAAGGCGGCCAAGAAGAGCGAGAAGGCTACGACGGAAGAAGCCAAGCCAGAAGGTGAAGCTGCCGAAAAGGAAGAC
GAAGAGATCGACGTGCCGCTCGAGGACATCCCGCTTGTGCGCTTGAACCCGAACGTGTTTATGAAGTACAACGCGTGTGTCGACGAGACCGAGGCCAAGG
CCGACGAAGAAGTCGCGAATGACGCCGCTGCGTACCTGCAGAACGTCGTGATCCCAGCGTTCGTGTCGGACGTCCGTCGCGGCGCGATCTCGCCTGCCGA
CGGCTTTGCGCTCACCGAGTTGATGCACTCGTGCGGTATTAACATGCGCTACTTGGGTCGCATTGCGTCGCTCGCCAAGAAACTCGAGTCCATTGGCGGC
ATCTCCAAGTACACGCTCGAGCTGCTGGAAGCGGAGATGCTCGCGCGTGCGACGAAGCACCTGCTCGCGGATGTCCTGAACGCTGACGAGGCCACGCGCG
CCGCGCCGGGCGACGTGCTAGTGCGCATTCTGAATGGCATCTTTGGGGCGGCGGCGCTCAAGAGTGATGAGGACTTCAGCAGCAGCAAGGCCAAGGTCGG
CAACAACGGCAAGAAGTCGGACAAGGGCGGCAAGCAGCCTGCGCCACAGCCGCAGACGCCGGCGAAGAAGCGCAAGTCGAGTGTGTCGATCGTTATCCCC
GAGCGCGAAGAGCCGGCTGCTGTTGTGTCAGTGGCGGAGACGCTCGATGCCAAGACGATCTGGCAGCGTCTCGAGAAGGAGATCCAGAGCCGCTTCGACT
ACACGCTGACGCTGTGGAACCGCGAGGAAGACGTCGACAGCACCGAAGTGCCGCTCGGCCGCGTGCACAAGACCGTGCTGCTGCGCCGTCTCTGCCAGCG
CAACGGACTGCGCGTCGTGAGCCGCAACTACGACTTCTCGTCGCGCGAGCCGTTCCAGATCGACGACATCACAGGTGTCGTGCCGGTCGTCAAGCACAGT
CTGCCGGCGCACCCGCTGGCGCACGCCAAGCAGCTTTTGGAGCGCGGCCGCCTGCACTTGAGCGGCGGCTCGCTGGCCACGGCGTACGAGCTGCTGCAGG
AGACGTCGGCGCTGTTGTTCCAGGTGTGTGGCGCGGCCCACGAAGACGCGGCGCTCTGCTCCACGTCGCTGGCGACCGTGTTGTACCACGCGGGCGACCT
CGCGGGTGCGATCGCGCAGCAGCAGCGCGCGCTCGCGCTGTACACGCAGCTGTGTGGCATCGATTACCACGACACGGCGTTCGCGCACGCCAACCTGGCG
CTGTTCCTGCACGCGAACGGCCAGACGGACGTTGCAGTCGCGCACTTGCGCCGCGCGATCTACCTGCTGGAACTGTGCGCTGGCCCACACTTTCCTGAGA
TCAGCTCGCTGTACTTCAAGATGGGCATGATGTGCCAGGACGTGGGCCAGATCACGTTGGCGCTGCTGTGCCACCGCGAGTCGCTCAAGCGCGGCGAGCT
GGACCGCATCCAGGCCGCCAATACGCTGCACCAGATGGCGCTCGCGTGCGGCCTCGCCGGCGGCTTCCGCGAGGCGCTCGCGTACGAGAAGAAGGTGTAC
TCGCTGTTCAAGGAGGCATTCGGCGAGGACGACCCGCGCGTGGTCGAGGCCACCAAGTTCATGGCCAAGTTCACGGAGCGCGCCGTGGAGGGCGCCAAGG
GCCGCGTGGAGGTCGACGCCGCGGCGCAGGCCGACGCCATCGCGCACGAGCTGCTGGCGGAGCTCACGATCAAGGACGAGGCCGCGACAGCGAGCAAGAA
GAAGAGCAAGAAGAGCAAGGCCAGCAAGAAGCACTAGACTGCTGCTCCAGAGTGAGGCTTTAGCTCTTGGATTAGTGCA